ID: 1117898326

View in Genome Browser
Species Human (GRCh38)
Location 14:60509686-60509708
Sequence CACGCAGCTTCTCAGCCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 424}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117898326_1117898329 -10 Left 1117898326 14:60509686-60509708 CCAGGAGGCTGAGAAGCTGCGTG 0: 1
1: 0
2: 5
3: 32
4: 424
Right 1117898329 14:60509699-60509721 AAGCTGCGTGGAAGACCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 68
1117898326_1117898330 -2 Left 1117898326 14:60509686-60509708 CCAGGAGGCTGAGAAGCTGCGTG 0: 1
1: 0
2: 5
3: 32
4: 424
Right 1117898330 14:60509707-60509729 TGGAAGACCCCTGGGACCTGTGG 0: 1
1: 0
2: 0
3: 31
4: 234
1117898326_1117898335 15 Left 1117898326 14:60509686-60509708 CCAGGAGGCTGAGAAGCTGCGTG 0: 1
1: 0
2: 5
3: 32
4: 424
Right 1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117898326 Original CRISPR CACGCAGCTTCTCAGCCTCC TGG (reversed) Exonic
900255751 1:1697606-1697628 CAGGCAGGGTCGCAGCCTCCTGG + Intronic
900264422 1:1750216-1750238 CAGGCAGGGTCGCAGCCTCCTGG + Intergenic
900389735 1:2428757-2428779 CACTCAGCCCCTCAGCCTCAGGG - Intronic
900460232 1:2799095-2799117 CTTCCAGCCTCTCAGCCTCCCGG + Intronic
900841189 1:5049838-5049860 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
900888218 1:5430345-5430367 CAGGCAGCCTCTCACCCTCCCGG + Intergenic
900888228 1:5430380-5430402 CAGGCAACCTCTCACCCTCCTGG + Intergenic
901223161 1:7595596-7595618 CCAGTGGCTTCTCAGCCTCCAGG - Intronic
901799754 1:11701197-11701219 CACGCAGCCGCTCATCCTCGCGG - Intronic
901949011 1:12726527-12726549 CCCGCTGTTTCTCAGCCTCTGGG + Exonic
902051281 1:13565408-13565430 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
902571511 1:17349978-17350000 CTGGCTGCTTCTCAGCCTTCAGG + Intronic
902609780 1:17590175-17590197 CACCGTGCTTCTCTGCCTCCAGG + Intronic
904631938 1:31848956-31848978 CCCTCAGCTTTTCTGCCTCCGGG + Intergenic
906423108 1:45687120-45687142 GACGCAGCCGCGCAGCCTCCGGG - Intronic
907321625 1:53606321-53606343 CACGCCCATGCTCAGCCTCCTGG - Intronic
907504816 1:54910445-54910467 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
907763434 1:57385117-57385139 GACACAGCTGCTCAGTCTCCAGG + Intronic
908378728 1:63573899-63573921 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
909729894 1:78877655-78877677 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
911071582 1:93835970-93835992 CACCCAGTTTCTCAGGCTCTTGG + Intronic
911924963 1:103817798-103817820 TACTCAGGTTCTCAGGCTCCCGG - Intergenic
911984267 1:104601145-104601167 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
912813914 1:112813882-112813904 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
912814909 1:112821340-112821362 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
912939293 1:114030847-114030869 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
913245595 1:116867467-116867489 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
913662465 1:121016447-121016469 CCCGCAGCTTCTCTCCCTCCGGG + Intergenic
913995657 1:143650416-143650438 CCCGCAGCTTCTCTCCTTCCGGG - Intergenic
914013845 1:143799643-143799665 CCCGCAGCTTCTCTCCTTCCGGG + Intergenic
914163979 1:145161554-145161576 CCCGCAGCTTCTCTCCTTCCGGG - Intergenic
914360611 1:146932814-146932836 CCCGCAGCTTCTCTCCTTCCCGG + Intergenic
914491975 1:148157825-148157847 CCCGCAGCTTCTCTCCTTCCCGG - Intergenic
914652468 1:149708262-149708284 CCCGCAGCTTCTCTCCTTCCGGG + Intergenic
915263214 1:154694535-154694557 CAAGCAGCACCTCACCCTCCTGG + Intergenic
915356068 1:155255685-155255707 CATCCAGCTTTTCAGGCTCCAGG + Intergenic
916156769 1:161858028-161858050 ACCGCAGCTTCTCAAACTCCTGG - Intronic
916329200 1:163595549-163595571 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
916584689 1:166140242-166140264 CATGCGGCTTCTAAGCGTCCTGG + Intronic
916942043 1:169686603-169686625 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
919922405 1:202174379-202174401 CACCCATCTCCTCAGTCTCCAGG - Intergenic
920364816 1:205442553-205442575 CCCTCAGCCTCTCAGCGTCCCGG + Intronic
920426909 1:205885817-205885839 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
920901187 1:210111995-210112017 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
920908464 1:210192476-210192498 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
921189460 1:212696963-212696985 CATGGAGCTTGTCAGCCTTCTGG + Exonic
922845004 1:228677819-228677841 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
923075551 1:230605829-230605851 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1063663292 10:8048224-8048246 CACCCAGCTCCTGAGCCCCCTGG - Intergenic
1066436728 10:35402841-35402863 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1067115671 10:43433841-43433863 ACCTCAGCCTCTCAGCCTCCCGG - Intergenic
1067179990 10:43977931-43977953 CAGGCAGATTCTCAGCCTAGGGG + Intergenic
1067251484 10:44590398-44590420 CCCCCAGATTCTCAGTCTCCTGG - Intergenic
1067799308 10:49348031-49348053 CAGTGACCTTCTCAGCCTCCAGG - Intergenic
1068955548 10:62816672-62816694 CAGGCTGCGGCTCAGCCTCCCGG + Intronic
1069608657 10:69757600-69757622 AACACAGCGTCTGAGCCTCCTGG + Intergenic
1069678760 10:70268647-70268669 CACTCAGCCTCTCATCCTCCAGG + Intronic
1069877018 10:71569139-71569161 CAGGCAGCCTCCCAGGCTCCAGG - Intronic
1069948005 10:72000741-72000763 CACCCAGCTTCTCAGCCACATGG - Intronic
1070647747 10:78213188-78213210 CTTGCAGCATCTCATCCTCCAGG + Intergenic
1070739762 10:78895036-78895058 CAGGCTGACTCTCAGCCTCCGGG + Intergenic
1071196763 10:83169511-83169533 CATCCTGCTTCTCTGCCTCCTGG - Intergenic
1071822149 10:89289656-89289678 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1072237500 10:93466032-93466054 CAGGCAGCCTGGCAGCCTCCAGG + Intronic
1073014463 10:100386889-100386911 CAAGCAGCTTCTCAGCCTCTTGG + Intergenic
1073101007 10:101006709-101006731 CCCGCAGCTGCTCAGCTTCCTGG - Exonic
1073130513 10:101185946-101185968 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1073509481 10:104034334-104034356 CATGCAGCTTCTCACCCTGCAGG - Exonic
1073683905 10:105732180-105732202 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1074300688 10:112230929-112230951 TCCCCAGCCTCTCAGCCTCCTGG - Intergenic
1074597548 10:114881372-114881394 CAATCAGCGTCTCAGCCCCCAGG - Intronic
1075014343 10:118899207-118899229 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1076695456 10:132245217-132245239 CACCCATCTGCTAAGCCTCCCGG + Intronic
1077475971 11:2790658-2790680 CTCTCAGCGCCTCAGCCTCCTGG + Intronic
1079250938 11:18787444-18787466 CATGCAGCTTCTCATTCTTCAGG + Intronic
1079772560 11:24480846-24480868 CAGGTAGCTTATCAGCATCCAGG + Intergenic
1079835594 11:25328940-25328962 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1080203860 11:29706647-29706669 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1082197347 11:49322164-49322186 CAAGCAGTTTCTCAGACTCTTGG - Intergenic
1083157976 11:60837088-60837110 CAGGCAGCTTCTCTGCACCCTGG + Intergenic
1083805946 11:65074022-65074044 CCAGTAGCGTCTCAGCCTCCAGG - Intronic
1084354637 11:68629565-68629587 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1084468950 11:69343951-69343973 CACGCTGCTTCACCGCCTGCCGG - Intronic
1084625526 11:70303605-70303627 CACAGAGCTTCTCAAGCTCCTGG + Intronic
1085038592 11:73313933-73313955 CCAGCTGCTTCTCAGCCACCAGG + Intronic
1085519836 11:77131311-77131333 CCAGCAGCTTCTCGGTCTCCAGG + Intronic
1085928250 11:81049074-81049096 CTGGAAGCTTCTCAGCCACCAGG - Intergenic
1086134376 11:83431888-83431910 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1086550635 11:88048365-88048387 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1086658470 11:89385960-89385982 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1087197314 11:95314497-95314519 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1089555670 11:119314947-119314969 CGAGCAGCGGCTCAGCCTCCAGG - Exonic
1089619074 11:119712275-119712297 CCCACTCCTTCTCAGCCTCCAGG + Intronic
1089760277 11:120717865-120717887 CCCCCAGCTGCTCAGCCTCCAGG - Intronic
1089953770 11:122552317-122552339 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1090025338 11:123162825-123162847 CAGGCAGCTTTTGAGCCTCCCGG - Intronic
1090268520 11:125370032-125370054 CTCGCAGCTGCTCAGACCCCTGG + Intronic
1091158181 11:133393613-133393635 CACGGAGCTTCTCACCCACTGGG - Intronic
1091288532 11:134423184-134423206 CCCGCAGCTTCTCTGGGTCCAGG - Intergenic
1092296824 12:7207564-7207586 CCCTCAGCTTCTCTGCCTGCTGG + Intronic
1093194341 12:16112305-16112327 CTCCCAGCCTCTCAGGCTCCAGG - Intergenic
1093358894 12:18200389-18200411 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1094826188 12:34270922-34270944 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1095508236 12:42921266-42921288 CACACAGCATCTCATTCTCCAGG - Intergenic
1095778623 12:46035287-46035309 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1095806328 12:46324455-46324477 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1096772561 12:53945381-53945403 CATGGAGCCTCTCTGCCTCCGGG - Exonic
1096906853 12:54944126-54944148 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1097338114 12:58407255-58407277 CACTAAGCATCTCAGCTTCCTGG - Intergenic
1097461714 12:59871433-59871455 CACCCAGATACCCAGCCTCCTGG + Intergenic
1097592767 12:61591850-61591872 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1097703656 12:62845965-62845987 CATCTAGCTTCTCAGCCTGCGGG + Intronic
1097942908 12:65331877-65331899 CATGCAGTTTCTCTGCTTCCAGG - Intronic
1098920350 12:76296794-76296816 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1102604955 12:114061187-114061209 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1102813482 12:115843816-115843838 CTCGCAGCTTCTGTGGCTCCCGG - Intergenic
1103412847 12:120725113-120725135 CACCCACCTTCACAGCCTCTGGG + Intergenic
1107219929 13:37970252-37970274 CAAGCAGTTTTTCAGGCTCCTGG - Intergenic
1108493229 13:51001374-51001396 CAACCTGCTTCTCAGGCTCCAGG - Intergenic
1108702873 13:52958662-52958684 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1112598275 13:100830122-100830144 CACACAGCTTCTCTTTCTCCAGG + Intergenic
1112733729 13:102394842-102394864 CACGCTGCAGCTCTGCCTCCAGG - Intronic
1113819679 13:113204189-113204211 CACTCCTCTTCTCAGGCTCCTGG - Intronic
1114234955 14:20815504-20815526 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1114257928 14:21018385-21018407 CATGCAGCTGCTAAGCCTCCAGG - Intronic
1114484724 14:23055866-23055888 CAAGCAGCTGCTCAGGCTCAAGG + Intronic
1117898326 14:60509686-60509708 CACGCAGCTTCTCAGCCTCCTGG - Exonic
1118238284 14:64032009-64032031 CACGCAGCTTCTCACAGTCAGGG + Intronic
1119550996 14:75514131-75514153 CACGCAGCTTCTGGGTCCCCAGG - Intergenic
1119559866 14:75581491-75581513 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1120753459 14:88219431-88219453 CAGGCAGCTTCTCAGGCTCAGGG - Intronic
1121192850 14:92045286-92045308 CAAGCAGTTTCTCAGGCTCTTGG - Exonic
1121389563 14:93562637-93562659 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1121882972 14:97516748-97516770 TACCCAGTTTTTCAGCCTCCTGG - Intergenic
1121896663 14:97654882-97654904 CAGGCATCATTTCAGCCTCCAGG - Intergenic
1122307798 14:100776686-100776708 CACACAGGTTCTGAGCTTCCTGG + Intergenic
1122380933 14:101306520-101306542 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1122508079 14:102244819-102244841 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1122803382 14:104244322-104244344 GACGGAGCTTCTCAGCCTCTTGG + Intergenic
1124019321 15:25904869-25904891 CACTCAGCTGCTGAGCTTCCAGG + Intergenic
1125849482 15:42889448-42889470 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1126195586 15:45926960-45926982 CACGCAGCGTTTCTGTCTCCAGG + Intergenic
1127856980 15:62961193-62961215 CCCTCAGCTGCTCAGCCTGCAGG + Intergenic
1127868072 15:63048073-63048095 CGCTCAGCTTCTCTGGCTCCCGG + Intronic
1128299911 15:66560041-66560063 CACGCCGCTTCACTGCATCCTGG + Intronic
1128379985 15:67105410-67105432 CCGGCATCTTCTCAGCATCCTGG - Intronic
1128476916 15:68005241-68005263 CCAGCAGCTTCTCAGCTTCTGGG - Intergenic
1128730376 15:70016656-70016678 CAAACAGCCTCTCAGCCTGCTGG - Intergenic
1128790627 15:70431218-70431240 CAAGAAACTTCTCAGCCTTCAGG + Intergenic
1129122910 15:73413574-73413596 ACCTCGGCTTCTCAGCCTCCCGG - Intergenic
1129164915 15:73771450-73771472 CAGGCAGGTCCTCAACCTCCTGG - Intergenic
1129259813 15:74358812-74358834 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1129699874 15:77761710-77761732 AAGGCAGCTTCTCAGCTTCAGGG + Intronic
1130147242 15:81283237-81283259 CCTCCAGCTTCTCTGCCTCCCGG - Intronic
1130304948 15:82707151-82707173 CAAGCAGTTTCTCAGGCTCCTGG + Intronic
1131165137 15:90136660-90136682 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1131604662 15:93888683-93888705 CATGTGGCTTCTCATCCTCCAGG + Intergenic
1132058254 15:98668929-98668951 CAATCACCTTCCCAGCCTCCTGG - Intronic
1132087796 15:98922367-98922389 AGCCCAGCTTCTCAGCCTCGTGG - Exonic
1132143881 15:99415396-99415418 CAGGCTGCTTCTCAGCCTGCAGG - Intergenic
1132853076 16:2033470-2033492 CCGGCAGCCGCTCAGCCTCCCGG + Intronic
1133611981 16:7442087-7442109 CAGGCTGTTGCTCAGCCTCCAGG + Intronic
1135938357 16:26799867-26799889 CTTGCATCTTGTCAGCCTCCAGG - Intergenic
1136479739 16:30534053-30534075 CAGGCAGGGGCTCAGCCTCCTGG + Intronic
1137363868 16:47843764-47843786 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1137534724 16:49311201-49311223 CACGGAGCTTCGCGGACTCCTGG - Intergenic
1137896245 16:52216137-52216159 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1138458432 16:57134174-57134196 CATCCTGCTTCTCTGCCTCCAGG - Intronic
1138758675 16:59518230-59518252 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1139404588 16:66707874-66707896 CCCCCAGCCTCCCAGCCTCCTGG - Intergenic
1141677536 16:85525422-85525444 CTCGCTCCTTCTCAGCATCCTGG - Intergenic
1142014288 16:87735807-87735829 CACGCAGCTGCTGAGCCTCGAGG - Intronic
1142394338 16:89823010-89823032 AACTTACCTTCTCAGCCTCCAGG + Intronic
1142419477 16:89961668-89961690 CACACAGCTTTCCAGCCTCATGG - Intronic
1142757274 17:2023891-2023913 GCCGCGGCTTCTCAGCCTCCTGG + Intronic
1142791863 17:2272861-2272883 AACTCAGCTCCTCCGCCTCCTGG - Intronic
1142863679 17:2777942-2777964 CTCCCAGCCTCCCAGCCTCCTGG - Intronic
1144951836 17:18998570-18998592 CAGGCAGCTGCTCAGCCACTGGG - Intronic
1146008407 17:29176760-29176782 CACGGAGCTTATCTGGCTCCAGG + Intronic
1147922384 17:43925874-43925896 CAGGCTGCAGCTCAGCCTCCAGG - Intergenic
1148115281 17:45171710-45171732 CTGGCAGCTTCCCTGCCTCCAGG - Intergenic
1148128898 17:45250895-45250917 CACTCAGGTACTCAGACTCCAGG + Intergenic
1149220941 17:54414710-54414732 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1152026682 17:77814200-77814222 CATGTTGCTTCTCATCCTCCAGG - Intergenic
1152261162 17:79268099-79268121 AACGCATCTACTCCGCCTCCAGG - Intronic
1152447442 17:80354038-80354060 CACACAGCTTCTCAGCAGCCTGG - Exonic
1152454393 17:80404948-80404970 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1152678135 17:81651932-81651954 CACGCACCTGCCCAGCATCCTGG - Intronic
1153624803 18:7013539-7013561 TACGCAGCCACTCAGCCTCTGGG + Intronic
1153897269 18:9577163-9577185 CAAGCAGCTTTTCAGTCTCTGGG - Exonic
1153960186 18:10133738-10133760 CACAGAGCTTCTAAGCCTCTTGG - Intergenic
1155941952 18:31808789-31808811 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1156489080 18:37485751-37485773 CTCGGAGCTTCTCTGCCTCTCGG + Intronic
1156894452 18:42229539-42229561 CCTGGAACTTCTCAGCCTCCAGG - Intergenic
1156923711 18:42553639-42553661 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1157244220 18:46039365-46039387 CCCACAGCTCCTCATCCTCCTGG + Intronic
1157554988 18:48607607-48607629 CAGACAGGTCCTCAGCCTCCAGG + Intronic
1157784719 18:50471167-50471189 CTGGCTCCTTCTCAGCCTCCAGG + Intergenic
1158576403 18:58642433-58642455 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1159929566 18:74296965-74296987 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1160009875 18:75098349-75098371 CACTCGGCTGCTAAGCCTCCTGG + Intergenic
1160543559 18:79638436-79638458 CACGCAGCTGCCCAGGCCCCGGG - Intergenic
1161103018 19:2430620-2430642 CAAGCATCTTCTAAACCTCCGGG + Exonic
1161225390 19:3142344-3142366 CACGCAGCTCTTCAGGCTTCGGG + Intronic
1161827162 19:6575736-6575758 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1162793861 19:13076816-13076838 CTGGCAGCTTCTCCTCCTCCTGG + Intronic
1163004777 19:14390224-14390246 CACCCAGCTTCTCTCTCTCCAGG - Intronic
1163062896 19:14773210-14773232 CACGCAGCTTCTCTCTCTCCAGG + Intronic
1163497690 19:17656151-17656173 CAGGCAGCTCCTCCTCCTCCAGG + Exonic
1163899750 19:20090968-20090990 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1163944052 19:20519775-20519797 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1164153377 19:22573229-22573251 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1164692959 19:30224478-30224500 CACGCAGGTTCTCTGCCTTATGG - Intergenic
1165495438 19:36149981-36150003 TACCCAGCTTCTCAACATCCAGG + Exonic
1165581165 19:36865041-36865063 CAAGCAGCTTCTCTAGCTCCCGG - Intronic
1166305272 19:41934018-41934040 CTGGCAGGTTCTCAGCCTCTTGG - Intergenic
1166524337 19:43501790-43501812 CCCGCAGCTGCTCCTCCTCCCGG + Exonic
1166651423 19:44578095-44578117 CAAGAAGCTTCTTGGCCTCCTGG + Intergenic
1166894415 19:46015136-46015158 CGCGCAGCGCCTCGGCCTCCTGG - Exonic
1167571598 19:50292359-50292381 GCCGCAGCACCTCAGCCTCCAGG - Exonic
1167682430 19:50932246-50932268 CTCCCTGCTCCTCAGCCTCCTGG + Intergenic
1167917716 19:52755603-52755625 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1168104694 19:54159593-54159615 CACGCTCCTTCTCCTCCTCCCGG + Exonic
1168315306 19:55482378-55482400 CCCGCAGCTGGCCAGCCTCCTGG + Exonic
925049046 2:796799-796821 CACCCAGGTTCACAGCCTCAGGG - Intergenic
925951057 2:8911601-8911623 CACTCACCTTCTCATCCCCCAGG - Intronic
926294260 2:11556737-11556759 CAAGCTGCTGCTCAGCTTCCAGG - Exonic
926704442 2:15826685-15826707 CAAGCTCCTCCTCAGCCTCCTGG - Intergenic
927134547 2:20087186-20087208 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
928265969 2:29812212-29812234 CACACAGCATCTAAGCCTGCCGG + Intronic
928406468 2:31018834-31018856 CACACAGCTGCTGAGCCTGCAGG - Intronic
928636368 2:33250970-33250992 CAGGCAGGTTCTCAGGCTCCTGG - Intronic
928904503 2:36355870-36355892 CCCGCAGCGGCGCAGCCTCCGGG - Intergenic
929778422 2:44942626-44942648 CGCGCAGCTTCTCGGCCTCCTGG - Exonic
930098583 2:47585975-47585997 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
933138348 2:78762853-78762875 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
933773503 2:85758401-85758423 CACGCAGTTTGCCAGCCTCCAGG + Intronic
934766285 2:96881887-96881909 CACCCAGCCACCCAGCCTCCAGG - Intronic
935047537 2:99495537-99495559 CAAGCAGAGTCTCAGCCTCCTGG + Intergenic
937223416 2:120354750-120354772 CACGCAGCCTCACAACCTCAAGG - Intergenic
937261081 2:120587182-120587204 CACTGAGCCACTCAGCCTCCGGG + Intergenic
937313961 2:120919484-120919506 CATGCACCTTCCCAGCCTTCAGG - Intronic
937726885 2:125176802-125176824 CTGGCAGCTTCTCAGCTTCCAGG - Intergenic
938161459 2:128988146-128988168 CCCGCACCTCCTCAGCCTCCTGG - Intergenic
938190407 2:129274357-129274379 CATTCAGCTTCTTAGGCTCCTGG + Intergenic
938379636 2:130829287-130829309 CAAGCCCCTGCTCAGCCTCCAGG - Intergenic
939460356 2:142490631-142490653 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
940508419 2:154584190-154584212 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
941116768 2:161480602-161480624 CACCCAGCTTCTCAGCTGGCCGG - Intronic
941431535 2:165419992-165420014 CACGCTGGTTCTCAAACTCCTGG + Intergenic
941751018 2:169135520-169135542 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
942586488 2:177484837-177484859 AACGCAGCCTCTCAATCTCCTGG + Intronic
945858905 2:215098345-215098367 CACAGAGCTTCTCAAACTCCAGG + Intronic
946183526 2:217963493-217963515 TGCGCAGGTTCTCAGCTTCCTGG - Intronic
946871319 2:224088303-224088325 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
948076774 2:235171077-235171099 CAAGCCTCATCTCAGCCTCCTGG - Intergenic
948214774 2:236220490-236220512 AATGCTGCTTCTCTGCCTCCTGG + Intronic
948554215 2:238796105-238796127 CATCAAGCTCCTCAGCCTCCGGG + Intergenic
1169183793 20:3594607-3594629 CAGGCAGCTGCACAGCCTCTTGG - Intronic
1169473770 20:5911642-5911664 AACGCTGCTTCTCAGCCTCCTGG + Exonic
1172560549 20:35884221-35884243 AACGCAGCATCCCAGCTTCCAGG - Intronic
1172957131 20:38768978-38769000 GAGGCAGCTTCCCAGCCTCTAGG + Intronic
1173136968 20:40447240-40447262 CTCAGAGCCTCTCAGCCTCCTGG - Intergenic
1173195208 20:40908601-40908623 CATGCGGCATCTCAGGCTCCAGG + Intergenic
1174481445 20:50834015-50834037 AAGGCAGCTTCTCAGGCACCTGG + Intronic
1174979402 20:55376172-55376194 CCTGCAGCTTCTCTGACTCCTGG + Intergenic
1176383560 21:6125972-6125994 CACGGAGCTGCTCTGTCTCCAGG + Intergenic
1178885302 21:36480130-36480152 AACTCAGCTTCTCAGCCTTTAGG + Intronic
1179710450 21:43210272-43210294 CACGCAGCCTCTCTGCCTCCCGG + Intergenic
1179739910 21:43412266-43412288 CACGGAGCTGCTCTGTCTCCAGG - Intergenic
1180611668 22:17102173-17102195 CACGCAGCTGGTGGGCCTCCAGG - Exonic
1183354396 22:37350607-37350629 CACACACGCTCTCAGCCTCCAGG - Intergenic
1183597312 22:38820482-38820504 CATGCAGCTGCTCAGACACCTGG + Exonic
1184271669 22:43387953-43387975 CCTGCACCTTCCCAGCCTCCTGG + Intergenic
1184477333 22:44728828-44728850 CCTGCCCCTTCTCAGCCTCCAGG + Intronic
1184643029 22:45882271-45882293 CACGGAGCTTGCCAGCCGCCAGG - Intergenic
1185041048 22:48504591-48504613 CACAGAGCTTCACAGACTCCTGG + Intronic
1185106566 22:48873134-48873156 CTTGCAGCTCCTCAGCCACCGGG - Intergenic
949671491 3:6402111-6402133 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
949943653 3:9173557-9173579 CAAGCATCCTATCAGCCTCCAGG - Intronic
950030738 3:9851450-9851472 CAAGCAGTTTCTCTGCTTCCAGG - Intronic
950177353 3:10884227-10884249 CAAGCAGCGTTTCAACCTCCAGG - Intronic
950364722 3:12474889-12474911 CCTGCAGCCTCTCAGCCCCCAGG + Intergenic
950680757 3:14583530-14583552 CTCCCAGCCTCCCAGCCTCCCGG - Intergenic
950714224 3:14836408-14836430 TAGGCAGCTGCTCAGCCTCTGGG + Intronic
950737417 3:15021265-15021287 CACGTAGCCTCTCAGCCACAGGG + Intronic
951024477 3:17815251-17815273 CACGAAGCCTCTCAGACACCTGG - Intronic
951762355 3:26160907-26160929 CAAGCAGCTTCTCAGGCTCTTGG - Intergenic
952297335 3:32072942-32072964 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
952838984 3:37628364-37628386 CACACAGCGTCACTGCCTCCTGG - Intronic
953656088 3:44856031-44856053 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
954215401 3:49121677-49121699 AACCCACCTGCTCAGCCTCCTGG + Exonic
956750590 3:72341133-72341155 CACCCAGGTTCTCAGCCTCCTGG - Intergenic
956777859 3:72580563-72580585 CAGGTAGCCTCTCATCCTCCAGG - Intergenic
956915980 3:73871356-73871378 CACCCAGCTGCTCATCTTCCTGG + Intergenic
957451854 3:80389852-80389874 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
957734490 3:84188679-84188701 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
957904398 3:86538727-86538749 CAAGCAGTTTCTCAGGCTCTAGG - Intergenic
957986091 3:87574160-87574182 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
958422398 3:93943115-93943137 CAAGCAGTTTCTCAGTCTCTTGG + Intronic
960704761 3:120471166-120471188 CTCACAGCTTGTCAGCTTCCAGG - Intergenic
961623245 3:128240953-128240975 AACACAGCTTCTCAGACTCCAGG - Intronic
961712313 3:128837065-128837087 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
961828446 3:129611151-129611173 CCTGCAGCTGCACAGCCTCCAGG + Intergenic
962164233 3:133032311-133032333 CACAGAGCTTCTCAGCCTGAAGG + Intergenic
962523525 3:136218460-136218482 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
962531173 3:136281976-136281998 CAAGCAGCTTCCCAGCCACAAGG - Intronic
963043911 3:141088654-141088676 CCCCCAGCTCCCCAGCCTCCAGG + Intronic
963320204 3:143802653-143802675 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
964184830 3:153930211-153930233 CAAGCACCTTCTGAGCCACCTGG + Intergenic
965335558 3:167427954-167427976 CAAGCAGTTTCTCAGACTCTTGG + Intergenic
965861559 3:173156479-173156501 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
966397215 3:179516237-179516259 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
967004916 3:185375063-185375085 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
968660869 4:1798224-1798246 ACCCCAGCTTCTCAGCCCCCAGG + Intronic
968872946 4:3250722-3250744 CACTCAGCTGCTCCACCTCCGGG + Intronic
969040473 4:4291573-4291595 CACCCTGCTTTTAAGCCTCCTGG - Intronic
969211115 4:5687946-5687968 CACGCAGCTTCTCAGTCACAAGG + Intronic
969534500 4:7747536-7747558 CACTCAGCTTCTCTGCAGCCTGG - Intergenic
970072286 4:12174623-12174645 CACTCACCTTATCAGCTTCCTGG - Intergenic
971553303 4:27980301-27980323 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
974063370 4:57055161-57055183 CACGCAGAGCCTCAGCCACCGGG + Intronic
974173071 4:58292361-58292383 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
980297971 4:130947354-130947376 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
980928124 4:139158959-139158981 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
981547492 4:145909453-145909475 CAGCCAGGTTTTCAGCCTCCTGG - Intronic
981916012 4:150034068-150034090 CATGCAGTTTCTCTGACTCCTGG - Intergenic
982316101 4:154033733-154033755 CTTACTGCTTCTCAGCCTCCAGG + Intergenic
983056218 4:163101593-163101615 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
983883337 4:172956886-172956908 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
984617373 4:181913926-181913948 CACATTGCTTCTCAGCCTCCTGG - Intergenic
985078591 4:186242878-186242900 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
986331223 5:6717287-6717309 CAAGCAGCTTCTCAGCAACAAGG - Intronic
987108661 5:14664727-14664749 GCCGCAGCCTCTCAGCCGCCGGG - Exonic
988199531 5:28050848-28050870 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
989581493 5:43037515-43037537 CACCCAGCACCTCAGCGTCCTGG + Intergenic
990980469 5:61598328-61598350 CCTGCAGCTGCTCAGCCACCTGG + Intergenic
992451605 5:76881190-76881212 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
996290170 5:121843551-121843573 CAGGCTGGTTCTCAGACTCCAGG - Intergenic
996358292 5:122620160-122620182 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
996369935 5:122742397-122742419 CCTGCAGCTTCTCTGACTCCTGG - Intergenic
996574629 5:124967629-124967651 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
999133102 5:149299534-149299556 CACCGGGCTGCTCAGCCTCCTGG + Exonic
999514682 5:152289053-152289075 CACAGAGCTTGGCAGCCTCCAGG + Intergenic
999780915 5:154849432-154849454 CAGGCAGATTCTCGGCCTCATGG - Intronic
1000427851 5:161113994-161114016 GAAGCAGCTATTCAGCCTCCTGG + Intergenic
1001353838 5:171001738-171001760 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1001641103 5:173244684-173244706 CGCGCAGCTTGTTGGCCTCCGGG - Intergenic
1002320256 5:178371312-178371334 CACACAGCCTCTCACCCTCTAGG - Intronic
1002640482 5:180628380-180628402 CCAGCAGCTTGTCGGCCTCCTGG + Intronic
1002702390 5:181133829-181133851 CGCTCAGCTTCCCAGCCTCTGGG - Intergenic
1002914570 6:1518706-1518728 CTGACAGCTTCTCATCCTCCAGG + Intergenic
1003503988 6:6725077-6725099 TACTCAGCTCTTCAGCCTCCTGG + Intergenic
1004773350 6:18812229-18812251 AACCCAGGTTCTCATCCTCCTGG - Intergenic
1005749268 6:28868028-28868050 CACTCAGCATCTCAGTCTCTGGG - Intergenic
1006325231 6:33348638-33348660 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1007084305 6:39132487-39132509 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1007300519 6:40864620-40864642 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1007990979 6:46255702-46255724 CACGCAGCTTATCTGGCTCATGG - Intronic
1009270199 6:61604945-61604967 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1009343655 6:62588493-62588515 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1009379517 6:63010158-63010180 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1009591262 6:65673685-65673707 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1010586292 6:77661274-77661296 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1013807650 6:114012838-114012860 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1014114889 6:117660065-117660087 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1016232592 6:141824401-141824423 ACCTCAGCTTCTCAGACTCCAGG + Intergenic
1016384861 6:143520745-143520767 CACGCTGCATCTCAAACTCCTGG + Intergenic
1016559822 6:145383412-145383434 GCCGCAGCTACTCAGCTTCCAGG + Intergenic
1016751094 6:147631515-147631537 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1017527730 6:155256827-155256849 CAGGCTGCTGCTCAGCCTCGGGG - Exonic
1017876850 6:158531864-158531886 CACACAGCCTCTCATCCTCCAGG + Intergenic
1017922421 6:158883917-158883939 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1018078001 6:160233358-160233380 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1019371555 7:664492-664514 CGTGCAGCATCTCAGCCCCCAGG + Intronic
1019474275 7:1236530-1236552 CACGCAGCCGCTCGGCTTCCTGG + Exonic
1019631803 7:2053519-2053541 CACACAGCTTCTCTACTTCCCGG - Intronic
1019636928 7:2081027-2081049 CAGGCATCTTCTCACCCTTCAGG - Intronic
1019694356 7:2436858-2436880 CACGCACCTGCTCAGATTCCCGG + Intergenic
1019959576 7:4447977-4447999 CCGGCTCCTTCTCAGCCTCCAGG + Intergenic
1020540698 7:9458996-9459018 CAAGCAGTTTTTCAGGCTCCTGG - Intergenic
1021173115 7:17419071-17419093 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1021660993 7:22917713-22917735 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1021853895 7:24834494-24834516 CGCGCAGATTCCCAGCCCCCTGG - Exonic
1022373194 7:29789265-29789287 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1022497864 7:30864592-30864614 CCAGCAGCTCCTCAGCCTGCTGG + Intronic
1023393685 7:39733233-39733255 GACGCAGCTTCGTCGCCTCCAGG - Intergenic
1023956935 7:44894069-44894091 AACGCAGCTTCCCAACCTCTGGG - Intergenic
1024104976 7:46074177-46074199 CACTCAGCATCACATCCTCCAGG - Intergenic
1024738824 7:52334210-52334232 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1026902278 7:74043831-74043853 CTAGCAGCAGCTCAGCCTCCAGG - Intronic
1027126573 7:75560597-75560619 TCCACAGCTTCTCAGCCTCGTGG + Intronic
1027158780 7:75787252-75787274 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1027354756 7:77344219-77344241 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1029459006 7:100684876-100684898 CCACCAGCTTCTCCGCCTCCTGG + Exonic
1029692087 7:102189229-102189251 CACGCTGCTTTTCAGACACCAGG + Intronic
1030193946 7:106835032-106835054 CAAGCTGCTTCTCAGGCTCTTGG + Intergenic
1031704228 7:124961622-124961644 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1031704239 7:124961703-124961725 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1031777773 7:125922835-125922857 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1032001043 7:128265476-128265498 CAAGCACCTTCCCAGCATCCAGG + Intergenic
1032516401 7:132509258-132509280 CACACAGTTTCTCCGTCTCCAGG + Intronic
1033644021 7:143287467-143287489 CACGCATGTCCCCAGCCTCCTGG + Exonic
1034440014 7:151081572-151081594 CACCCTGCTCCTCAGTCTCCTGG - Exonic
1034589991 7:152130904-152130926 GACGCTGCTTCTCACCCTTCGGG - Intergenic
1035035146 7:155889893-155889915 CACTCAGCTGCACAGCATCCCGG - Intergenic
1035440215 7:158891085-158891107 CACACAGTTTGTCAGCCACCAGG + Intronic
1035972416 8:4264510-4264532 AACGGAGCTTCTCAGCTTCAGGG - Intronic
1036471934 8:9060155-9060177 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1036550102 8:9808064-9808086 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1036635224 8:10545989-10546011 CACGCAGCATCTGAGCCTCAGGG - Intronic
1037039341 8:14211318-14211340 CATGAAGCTTCTCTGCCTTCAGG + Intronic
1037879063 8:22564276-22564298 CACGCAGGTGCTCAGACGCCGGG + Exonic
1038090249 8:24245223-24245245 CAGCCAGCCTGTCAGCCTCCCGG + Intergenic
1038307778 8:26420311-26420333 CTCACAGCTTCTCAGCTTTCAGG - Intronic
1039624942 8:39039672-39039694 CACGCAGCATAACATCCTCCAGG + Intronic
1040648435 8:49424726-49424748 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1040983059 8:53265803-53265825 CACTCAGCTGCTGAGCCTGCTGG - Intergenic
1041651415 8:60307008-60307030 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1041917097 8:63148878-63148900 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1044365262 8:91337606-91337628 CATGCTGCTTCACAGCCTGCTGG - Intronic
1045533223 8:103003622-103003644 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1045645111 8:104290365-104290387 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1046075275 8:109305380-109305402 CAAGCAGTTTCTCAGTCTCTTGG + Intronic
1046962560 8:120125974-120125996 CACGAAGCATCCCAGCCTCCCGG - Intronic
1048195866 8:132331340-132331362 CAGTCAGGGTCTCAGCCTCCAGG + Intronic
1048690533 8:136957558-136957580 CAAACACCTTCTCAGCCTCAGGG + Intergenic
1049435326 8:142583750-142583772 CACACAGCTTCTCAGGGACCTGG + Intergenic
1050140925 9:2514840-2514862 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1051717608 9:20001302-20001324 AACGCACCCTCTCACCCTCCTGG + Intergenic
1055447098 9:76394369-76394391 GACGCAGCTCCTCAGGCGCCCGG - Exonic
1056286152 9:85089790-85089812 CACACAGTTTCTCAGTCTCATGG - Intergenic
1056452207 9:86727245-86727267 CACGTAGCCTCTCATCCTCCAGG + Intergenic
1056485692 9:87054978-87055000 CACGCACCTTCTCTGCATTCAGG - Intergenic
1056597965 9:88023188-88023210 CCCGCATCTGCTCAGCCTCTGGG - Intergenic
1058895398 9:109396509-109396531 GACCCTGCCTCTCAGCCTCCTGG - Intronic
1061402914 9:130378270-130378292 CTCCCAGCTTCTCTGACTCCCGG - Intronic
1061612036 9:131753436-131753458 CAGGCTGGGTCTCAGCCTCCTGG + Intergenic
1061792759 9:133067084-133067106 AACCCACCTTCTCAGCCACCTGG - Exonic
1061896975 9:133653305-133653327 CAAGAAGCTTCTCAGCACCCGGG + Intronic
1061900893 9:133671445-133671467 TAAACAGCTTCTCGGCCTCCAGG + Intronic
1062376389 9:136263753-136263775 CACGCAGCTGTTCAGGCACCGGG - Intergenic
1185643431 X:1600652-1600674 CCCGTAGCTTCACAGCCTGCGGG - Exonic
1188300711 X:28503645-28503667 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1189777674 X:44484781-44484803 AACTCAGCTTCTCAGGCCCCAGG - Intergenic
1191805374 X:65130245-65130267 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1191826003 X:65365087-65365109 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1192706565 X:73532732-73532754 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1192731105 X:73803478-73803500 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1192935859 X:75858083-75858105 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1193537514 X:82732035-82732057 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1195016667 X:100787995-100788017 CAAGCAGTTTCTCAGGCTCCTGG - Intergenic
1195290764 X:103430294-103430316 CAAGCAGTTTCTCAGGCTCCTGG - Intergenic
1195326447 X:103762392-103762414 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1197500150 X:127231772-127231794 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1197750997 X:129963425-129963447 GACTCAGCTTCCCAGGCTCCAGG - Intergenic
1199602902 X:149553490-149553512 CACTCAGCTTGTCAGGGTCCAGG + Intergenic
1199647487 X:149925985-149926007 CACTCAGCTTGTCAGGGTCCAGG - Intergenic
1200046737 X:153407169-153407191 CACGCTCCAGCTCAGCCTCCGGG + Intergenic
1200063249 X:153492891-153492913 CACTCAGGGCCTCAGCCTCCAGG - Intronic
1201307145 Y:12560813-12560835 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1201891362 Y:18947068-18947090 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic