ID: 1117898335

View in Genome Browser
Species Human (GRCh38)
Location 14:60509724-60509746
Sequence CTGTGGACAAGTACCGAGTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117898326_1117898335 15 Left 1117898326 14:60509686-60509708 CCAGGAGGCTGAGAAGCTGCGTG 0: 1
1: 0
2: 5
3: 32
4: 424
Right 1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117898335 Original CRISPR CTGTGGACAAGTACCGAGTA AGG Exonic
902162505 1:14542694-14542716 CTGTGGACTAGTAGAGAGTAGGG - Intergenic
906535787 1:46550342-46550364 CTGAGGACAAGCACCCAGTCCGG - Intronic
907379399 1:54073428-54073450 CTGTGGGCCAGTAGCGAGGAGGG - Intronic
907989545 1:59565961-59565983 CTGTGGTCAAGTACCAAATTTGG + Intronic
913614952 1:120549342-120549364 ATGTGGACAAGTTCCTAGTATGG - Intergenic
914575317 1:148961565-148961587 ATGTGGACAAGTTCCTAGTATGG + Intronic
917982731 1:180281735-180281757 CTGTGGAGAAGTATTGAGTTAGG + Intronic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
1066022325 10:31317013-31317035 CTGTGGACAAGTACCTTTTCAGG - Intergenic
1068671789 10:59730512-59730534 CTGTGGACCACTACAGAGCAAGG - Intronic
1070469240 10:76761964-76761986 TTGTGGACAAGTATCGAGCAGGG - Intergenic
1070498234 10:77044921-77044943 CTGTGTACAAGTACCAAAGAGGG + Intronic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1085525456 11:77161106-77161128 CTGTGAACAGGTACCGCGTGGGG + Exonic
1086513093 11:87581827-87581849 CTTTGGATATGTACTGAGTAGGG + Intergenic
1087241076 11:95780970-95780992 CTGTAAACAAGTACCAAGTTGGG + Intronic
1091942543 12:4501261-4501283 AGGTGGACAAGTAGGGAGTAAGG - Intronic
1093342074 12:17989637-17989659 CTGGGGACTAGAACAGAGTAAGG - Intergenic
1106585526 13:31053511-31053533 CTGTGGACAAGTGCCTGGGAAGG - Intergenic
1109759260 13:66805601-66805623 CAGTGGACAAGTACCTGGTTGGG - Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1137667880 16:50262233-50262255 CTGAGGAGAAGTACCCAGCAGGG - Intronic
1143815807 17:9513662-9513684 CTTTGGATAAGTGCCCAGTAGGG - Intronic
1149092358 17:52799042-52799064 ATATAGACAAGTACCGAATATGG + Intergenic
1151876437 17:76870050-76870072 CTGTGGCCACGTCCCGAGTCCGG - Intronic
1153913179 18:9721798-9721820 CGGTGCACAAATACCGAGTGTGG + Intronic
1157415981 18:47503452-47503474 CTGTGGCCAAGCACAGAGTGAGG + Intergenic
1161218348 19:3105933-3105955 CTGTGGACGAGTCCAGAGTGAGG + Intronic
935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG + Intergenic
936419589 2:112350474-112350496 CTGTGGACCAGTAAAGAGCAAGG - Intergenic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1181256253 22:21564755-21564777 CTGTGGAGAATTACGGAGGAAGG - Intronic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
951248544 3:20368019-20368041 CTGTGGACCACTACAGAGCAAGG - Intergenic
952278066 3:31896782-31896804 CTGTGGAAAGGTGCTGAGTAGGG - Intronic
954001921 3:47564416-47564438 CTCTGGAGAAGCACCGAGTGAGG - Intronic
958985283 3:100773586-100773608 CTTTGGACAAATACCTAGGAAGG - Intronic
960607482 3:119522048-119522070 CTTTGGATAAATACCTAGTAGGG - Intronic
964550334 3:157878137-157878159 CTGTGCACAAGTAGCAAGCAGGG - Intergenic
966700238 3:182841404-182841426 CTGTCGACAAATACACAGTAAGG - Intronic
967819274 3:193826160-193826182 CTGTGGAGAAGAACCAAGCATGG - Intergenic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
983251851 4:165354485-165354507 CTGTGGACCAGTACCCATCATGG - Intergenic
995130724 5:108627726-108627748 GAGTGGACAAGTACCTAGGATGG - Intergenic
995973304 5:118000123-118000145 CTATGGACAAATACAGTGTAAGG - Intergenic
1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG + Intergenic
1001568074 5:172713323-172713345 CTGTGGACAAATAAAGACTAAGG + Intergenic
1003621657 6:7706064-7706086 CTGAGGAAAAATACCCAGTACGG - Intergenic
1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG + Intergenic
1020992406 7:15216282-15216304 CTGTGGACAAGAACAGAGACAGG - Intronic
1034877393 7:154737619-154737641 CTGTGGACAAACAACCAGTAGGG + Intronic
1035166064 7:156990596-156990618 CTGTGGACAAGTGCTGAGATAGG + Intergenic
1036338407 8:7893798-7893820 TGGTGGAGAAGCACCGAGTAGGG - Intergenic
1053674021 9:40403701-40403723 CTGTATACAATTACTGAGTAAGG + Intergenic
1053923824 9:43030068-43030090 CTGTATACAATTACTGAGTAAGG + Intergenic
1054385125 9:64543770-64543792 CTGTGTACAATTACTGAGTAAGG + Intergenic
1054510604 9:65972589-65972611 CTGTATACAATTACTGAGTAAGG - Intergenic
1058006531 9:99922121-99922143 CTGTGGCCCAGTACTGTGTAAGG - Intronic
1058119113 9:101119147-101119169 CTGTGGACAAGAACATGGTAAGG - Intronic
1060486900 9:124053499-124053521 AGGTGGAAAAGTACCCAGTATGG - Intergenic
1060587564 9:124795939-124795961 CTGGGGACAAGGACAGAGTTGGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1191716130 X:64194782-64194804 CTGTGGACCAGCACTGAGCATGG + Intronic
1192302196 X:69916750-69916772 CTGTGTGAAAGTACCTAGTATGG + Intronic
1199490477 X:148393438-148393460 CTTTGGATAGGTACCTAGTAGGG - Intergenic