ID: 1117899200

View in Genome Browser
Species Human (GRCh38)
Location 14:60515334-60515356
Sequence CCCAGATCTGTGGCCTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117899200_1117899205 -10 Left 1117899200 14:60515334-60515356 CCCACGGAGGCCACAGATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1117899205 14:60515347-60515369 CAGATCTGGGTCCCCGAGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117899200 Original CRISPR CCCAGATCTGTGGCCTCCGT GGG (reversed) Intronic
900877712 1:5357217-5357239 CCCACATCTGTTGCCTCTATGGG + Intergenic
901051588 1:6428322-6428344 CCCATGTCTGTGGCCGCGGTGGG - Exonic
902482732 1:16720039-16720061 CCCATGTCTGTGGCCGCGGTGGG + Intergenic
902562686 1:17287629-17287651 CCCAACTCTGTGGCCTCCTGCGG + Intergenic
904429231 1:30451304-30451326 CTCTGCTCTGTGGCCTCCCTGGG - Intergenic
905742514 1:40384641-40384663 CCTTTATCTGTGGCCTCTGTGGG - Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907300750 1:53485080-53485102 CCCGGATCTCTGGCCTAAGTGGG + Intergenic
912869783 1:113293609-113293631 CCCTGGTCTGTGGCCCCAGTTGG + Intergenic
915496481 1:156285818-156285840 CTAAGGGCTGTGGCCTCCGTGGG + Exonic
916943901 1:169704717-169704739 CCCAGCTCTGGGGCCTCCAAAGG + Exonic
920899576 1:210093958-210093980 CCATGATCTGTGGCCACCCTAGG - Intronic
922303461 1:224323780-224323802 CCCTGCCCTGTGGGCTCCGTAGG - Intronic
922586077 1:226736194-226736216 CCCAGGGCCCTGGCCTCCGTAGG - Exonic
924224180 1:241907495-241907517 CTCAGCTCTGTGTCCTCTGTGGG + Intergenic
1073293734 10:102425801-102425823 GCCAGATCTGTGGGCTCCTCAGG - Intronic
1073426812 10:103459898-103459920 CACAGATCTGTGGGCCCCATGGG - Intergenic
1076264852 10:129101701-129101723 ACCAGGTCTGTGGCAGCCGTTGG + Intergenic
1077141434 11:1026594-1026616 CCCTGCTCTGTGGCCTTTGTGGG + Intronic
1077183690 11:1227333-1227355 ACCAGACCTGTGGCCTGTGTGGG + Exonic
1078019871 11:7648042-7648064 TCCAGAGCTGTGGCCTCATTAGG - Intronic
1078402941 11:11044260-11044282 CCCAAGGCAGTGGCCTCCGTGGG + Intergenic
1079087539 11:17457554-17457576 GCCAGATCAGTGGCATCCATGGG + Intronic
1080701859 11:34650710-34650732 CCCAGATCTGGGGGTTGCGTAGG + Intronic
1084297904 11:68225153-68225175 CCCAGCTCTCTTGCCTCAGTTGG - Intergenic
1084520537 11:69659949-69659971 CCCAGATCTGTGGTTTGAGTGGG + Intronic
1084774984 11:71369170-71369192 CCCTGCTCCCTGGCCTCCGTGGG - Intergenic
1085328084 11:75623960-75623982 CCCAGAGCTCTGGCCACCGCAGG - Intronic
1087124926 11:94615337-94615359 CACTGAGCTGTGCCCTCCGTAGG + Intronic
1092001524 12:5036542-5036564 CCCAGATCTGTGGGGTCCAGTGG - Intergenic
1100057467 12:90529789-90529811 CCCAGATCTGTATGCTCCCTGGG + Intergenic
1104602928 12:130165123-130165145 CCCAGCACTGTGGCCTTCCTGGG - Exonic
1104861693 12:131927546-131927568 CACAGAACTGTGGCCCCCCTGGG + Intergenic
1106308329 13:28532618-28532640 CCCCGATCTGTGCCCTGCGCGGG + Intergenic
1107559531 13:41547096-41547118 CCCAGACCCTTGGCCTCCCTGGG + Intergenic
1113901317 13:113799872-113799894 CACAGAGCTGTGCCCTCCGACGG - Intronic
1117899200 14:60515334-60515356 CCCAGATCTGTGGCCTCCGTGGG - Intronic
1118881288 14:69828328-69828350 ACCAGATCTGTGGACTCCATGGG + Intergenic
1119668053 14:76498840-76498862 CCCCCATCTGTGGCCTGGGTGGG + Intronic
1121261329 14:92568568-92568590 CCCAGGTCTGTGGTCTGCCTTGG - Intronic
1121422690 14:93826476-93826498 CCCTGCTCTGTGGTCACCGTGGG - Intergenic
1122355809 14:101122269-101122291 CCCCGATGTGTGGCCTCCTGGGG + Intergenic
1129003291 15:72351680-72351702 GGCAGATGTGTGGCCTCCTTTGG + Intronic
1129009969 15:72407001-72407023 CCCAGCTCTTTGGCCTCCAGAGG - Intronic
1131513394 15:93062159-93062181 TCCAACTCTGTGGCCTGCGTGGG + Intronic
1134409402 16:13991601-13991623 CCCAGAACTGGGGCCTCTCTAGG - Intergenic
1138454138 16:57111727-57111749 CCCAGATCTGGGGCCTTCCAAGG - Intronic
1141229219 16:82149141-82149163 GACAGGTCTGTGGCCCCCGTAGG + Intronic
1142734594 17:1888297-1888319 CCTAGATCTGTGGCCTTTGGAGG + Intronic
1144899334 17:18569452-18569474 TCCAACTCTGTGGCCTGCGTGGG - Intergenic
1149559470 17:57597991-57598013 CCCAGATCAGTGGCCACCAGAGG + Intronic
1152529912 17:80911922-80911944 CTCTGGTCTGGGGCCTCCGTGGG - Intronic
1154325811 18:13389654-13389676 CCCAGAACCCTGGCCTCTGTGGG - Intronic
1157405193 18:47416927-47416949 GACAGATCTGTGGCCTCCATAGG + Intergenic
1157628915 18:49077283-49077305 AGCAGATCTGTGGCTTCCTTGGG - Intronic
1157692157 18:49692309-49692331 TCCAGCTGTGAGGCCTCCGTGGG + Intergenic
1159350652 18:67268765-67268787 CTCAGATCTGGGGCTTCGGTGGG - Intergenic
1159441496 18:68486103-68486125 CACATATCTGGGGCCTCTGTTGG - Intergenic
1160870880 19:1277313-1277335 CCCAGCTCTGGGGCCTCGGTGGG + Intronic
1161122211 19:2535184-2535206 CCCAGATCTTTGGCCTCATGAGG - Intronic
1163595578 19:18219315-18219337 CCCGGATCAGTGGCCTACATGGG - Exonic
1165351539 19:35278568-35278590 CCCAGGGCTGTGGTCTCGGTGGG + Intronic
933743149 2:85550712-85550734 CCCAGAGCTGCAGCCTCTGTTGG - Exonic
936248541 2:110849265-110849287 CCCAGACCTGTGGACACAGTAGG - Intronic
937868223 2:126769676-126769698 CCCAGATCTATGGGCTGAGTAGG - Intergenic
946463458 2:219890542-219890564 CCCAGCTCTGTGGACAACGTGGG - Intergenic
948870945 2:240797748-240797770 GCCATCTCTGTGGCCTTCGTGGG + Exonic
1171962576 20:31505307-31505329 CCCAGATCTGTGAGCTTCCTTGG - Intergenic
1172424352 20:34845219-34845241 CCCTGATCTGGGGCATCCCTGGG + Exonic
1173726400 20:45301269-45301291 CCCTGGACTGTGGCCTCCGAGGG - Intronic
1174106134 20:48163687-48163709 CCCAAATCTGCAGCGTCCGTCGG + Intergenic
1174193860 20:48758948-48758970 GCCATATCTTTGGCCTCCGCAGG - Intronic
1175902431 20:62365440-62365462 CTCAGATCTGTCTCCTCTGTGGG - Intronic
1180800950 22:18631603-18631625 CCCACATCTGTAGCCTCTGCAGG + Intergenic
1181220768 22:21363659-21363681 CCCACATCTGTAGCCTCTGCAGG - Intergenic
1182718527 22:32378717-32378739 CCCATATCTGGGGCCCCTGTGGG - Intronic
1182769412 22:32783253-32783275 AACAGACCTGTGGCCTCAGTTGG + Intronic
1182878699 22:33714688-33714710 CTCAGGCCTGTGGCCTCCCTTGG + Intronic
1183145327 22:35985510-35985532 CCCAGATTTGTGGCTTCACTTGG - Intronic
1183226634 22:36554571-36554593 CACAGTTCTGTGGGCTCAGTTGG - Intergenic
1183544538 22:38448591-38448613 CCCAGAGCTGTGGGGTCTGTGGG - Intronic
1183622653 22:38983512-38983534 CCCAGCTCTGTGGCCTCGGCAGG + Intronic
1183629064 22:39022260-39022282 CCCAGCTCTGTGGCCTGGGCAGG + Intronic
1183632551 22:39042050-39042072 CCCAGCTCTGTGGCCTGGGCAGG + Intronic
1183638377 22:39078452-39078474 CCCAGCTCTGTGGCCTGGGCAGG + Intronic
1185134107 22:49058962-49058984 CCCAGACCTGGGGCCTCCCAGGG + Intergenic
954330148 3:49885526-49885548 CACAGAGCTGTGGGCTCCGAGGG + Intergenic
958844494 3:99249846-99249868 CTCAGAGCTGTGGCCTCCCTTGG + Intergenic
963037923 3:141048503-141048525 CCAAGATCTGTAGCATTCGTGGG - Intergenic
964134584 3:153330234-153330256 GCCAGATCTGTGGCCTGTGAGGG - Intergenic
965788697 3:172364327-172364349 CCCAGACCTGTGGCTTCCATTGG + Intronic
967976729 3:195039685-195039707 CCCAGAGCTGTGGCCACAGGAGG + Intergenic
968447857 4:661419-661441 CACAGCTCTGTGCCCTCCCTGGG + Intronic
968592697 4:1466723-1466745 TCCAGTGCTGTGGCCTCCCTGGG - Intergenic
968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG + Intergenic
968905127 4:3447390-3447412 CCCACACCATTGGCCTCCGTGGG + Intronic
970447616 4:16137101-16137123 CCCAGGTCTGAGGCCTCAGCTGG - Intergenic
974402414 4:61424486-61424508 CCCTGAGCTCTGGCCTACGTTGG - Intronic
984947843 4:184983673-184983695 CCCAGAGCTGTGGCTCCCATGGG + Intergenic
985619930 5:948883-948905 CGCAGAGCTCTGGCCCCCGTGGG + Intergenic
991196140 5:63934802-63934824 CCCAAATTTGTGGCCTCCATGGG - Intergenic
999858418 5:155619863-155619885 CTCAGAGCTGTGTCCTCCCTGGG - Intergenic
1004069876 6:12288455-12288477 CCGGGAGCTGTGGCCTCCCTGGG + Intergenic
1005650344 6:27879615-27879637 GCCTTATTTGTGGCCTCCGTGGG - Intergenic
1006782760 6:36643336-36643358 CCCAGCTCTGTGCTCCCCGTGGG - Intergenic
1007715360 6:43852449-43852471 CACAGCTCTCTGGCCTCCATGGG + Intergenic
1009274077 6:61652733-61652755 CCCAGAGCTGTGTCCTGTGTGGG + Intergenic
1018427306 6:163694945-163694967 CACAGATCTGTGGCGTCTATGGG + Intergenic
1018681399 6:166268852-166268874 CACAGAGCTGTGGCCTCAGGTGG - Intergenic
1018968655 6:168509121-168509143 CCCAGATCGGAGGCTTCCCTGGG + Intronic
1020246445 7:6432946-6432968 ACCAGATCTGTGTCCTGGGTGGG + Exonic
1025098537 7:56116319-56116341 CCCAGGCCTGTGGCCACCGGCGG + Exonic
1025109030 7:56197231-56197253 CCCAGGTCTGTGGAGTTCGTGGG - Intergenic
1027046404 7:74994172-74994194 CCCAGATCAGGGGCCACCCTGGG + Intronic
1027383659 7:77638710-77638732 CCAATATCTGTGGCTTCTGTTGG - Exonic
1031137308 7:117899285-117899307 ACCACATCTGTGGCTTCCATTGG - Intergenic
1035443054 7:158919980-158920002 TGCAGCGCTGTGGCCTCCGTCGG + Intronic
1036165229 8:6426363-6426385 ACCAGATCTGTGGCTGCCCTGGG - Intronic
1036572966 8:9997972-9997994 CCCTGATCTCTGACATCCGTGGG + Intergenic
1036662018 8:10714865-10714887 CCCAGCTGTGTGGCCTCCCTCGG + Intergenic
1036790952 8:11719398-11719420 CCTACATCTGTGCACTCCGTGGG - Intronic
1037606748 8:20444324-20444346 CCCAAGTCTGAGGCCTCTGTTGG - Intergenic
1037959491 8:23085072-23085094 CCCAGATCTGGGGCCTATGAGGG + Intronic
1041084121 8:54241534-54241556 TCCAGATCTCTGGCCTCAGCTGG + Intergenic
1047544045 8:125797933-125797955 CCCAGATCTGGAGCCACAGTTGG + Intergenic
1048062942 8:130939022-130939044 CCCAGATTTGTGGAGTCAGTGGG + Intronic
1049159628 8:141089052-141089074 CCCAGATGAGTGCCCTCCCTGGG + Intergenic
1049934169 9:484754-484776 CCCACATCTGTGGCCTGCAGTGG + Intronic
1057190186 9:93083019-93083041 CACAGATCTGTGGCCACTCTTGG - Intronic
1059809116 9:117836364-117836386 CCCAGGTCTGTGGTCCCCTTTGG + Intergenic
1059835234 9:118144595-118144617 CCCAGATCTATTGCCTACCTTGG - Intergenic
1061502701 9:131012990-131013012 CCCAGCCCCGTGGCCTCCCTGGG - Intronic
1061599563 9:131658607-131658629 GCCAGATCTGTAGCCTGCGATGG - Intronic
1061777744 9:132977292-132977314 CCCAGCTCTGTGGTCTCTCTTGG - Intronic
1187479548 X:19642622-19642644 TACAGATTTGTGGCCTCTGTGGG - Intronic
1190344158 X:49322228-49322250 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190345253 X:49331773-49331795 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190346347 X:49341339-49341361 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190347598 X:49532368-49532390 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190348699 X:49541924-49541946 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190349799 X:49551480-49551502 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190350904 X:49561033-49561055 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190352005 X:49570591-49570613 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190353106 X:49580140-49580162 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190354207 X:49589687-49589709 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1190355309 X:49599211-49599233 TCCTGGTCTGTGGCCTCCGAGGG + Intronic
1196592940 X:117509172-117509194 CCCAAATCAGTGACCTCAGTGGG - Intergenic
1199531533 X:148853326-148853348 CCCACATCTGTGACCTCTCTAGG - Intronic
1200008029 X:153100744-153100766 CCCAAATCTGTGACCGACGTCGG + Intergenic