ID: 1117903754

View in Genome Browser
Species Human (GRCh38)
Location 14:60563225-60563247
Sequence CTGTGGTTCTTGACAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117903754_1117903757 22 Left 1117903754 14:60563225-60563247 CCTTCATCTGTCAAGAACCACAG No data
Right 1117903757 14:60563270-60563292 AAACTTTAATAAAATTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117903754 Original CRISPR CTGTGGTTCTTGACAGATGA AGG (reversed) Intergenic
No off target data available for this crispr