ID: 1117909461

View in Genome Browser
Species Human (GRCh38)
Location 14:60622933-60622955
Sequence CAAACCACGCAAAACTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117909455_1117909461 5 Left 1117909455 14:60622905-60622927 CCCAAAATGATTTCTGTTTTGGA No data
Right 1117909461 14:60622933-60622955 CAAACCACGCAAAACTTGGTAGG No data
1117909456_1117909461 4 Left 1117909456 14:60622906-60622928 CCAAAATGATTTCTGTTTTGGAA No data
Right 1117909461 14:60622933-60622955 CAAACCACGCAAAACTTGGTAGG No data
1117909453_1117909461 24 Left 1117909453 14:60622886-60622908 CCTTAGTTTTGTACTGGGTCCCA No data
Right 1117909461 14:60622933-60622955 CAAACCACGCAAAACTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117909461 Original CRISPR CAAACCACGCAAAACTTGGT AGG Intergenic
No off target data available for this crispr