ID: 1117912398

View in Genome Browser
Species Human (GRCh38)
Location 14:60648396-60648418
Sequence ACCCGCGCGTGGGTTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117912398_1117912402 -6 Left 1117912398 14:60648396-60648418 CCCAGAGAAACCCACGCGCGGGT 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1117912402 14:60648413-60648435 GCGGGTGCTCAAAGCAAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 80
1117912398_1117912403 11 Left 1117912398 14:60648396-60648418 CCCAGAGAAACCCACGCGCGGGT 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1117912403 14:60648430-60648452 ATGAGGCCCCATCCTTAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117912398 Original CRISPR ACCCGCGCGTGGGTTTCTCT GGG (reversed) Intronic
900090528 1:918400-918422 ACCCACGCGTGAGCTGCTCTGGG - Intergenic
902528423 1:17074789-17074811 ACCCTCCCGAGGGTCTCTCTGGG + Intronic
908014342 1:59815319-59815341 ACCCGCAGGTGGCATTCTCTCGG - Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
1084327694 11:68411303-68411325 TCCTGCGCGTGGCTTTCTCCAGG + Intronic
1091450571 12:569988-570010 TCCTGCGCGTGGGTTCCTCGGGG - Intronic
1102645331 12:114400104-114400126 ACCCACGCGTGTGCATCTCTGGG - Intronic
1103967069 12:124646704-124646726 CCCCGCGCTCGGGTTTCTGTGGG - Intergenic
1104786965 12:131456257-131456279 ACAGGCACGTGGGTTGCTCTTGG - Intergenic
1117912398 14:60648396-60648418 ACCCGCGCGTGGGTTTCTCTGGG - Intronic
1142118036 16:88370533-88370555 ACCCACGTCTGGGTTCCTCTCGG + Intergenic
1142396663 16:89835822-89835844 TCCAGCGCGTGTGTCTCTCTGGG + Intronic
1143586817 17:7854582-7854604 ACCCCGGGGTGAGTTTCTCTGGG + Exonic
1150128427 17:62653315-62653337 CCCCGCCCCTGGGGTTCTCTGGG - Intronic
929092967 2:38237975-38237997 ACGTGTGCGAGGGTTTCTCTAGG - Intergenic
932333387 2:70914118-70914140 ACCTGAGCCTGTGTTTCTCTAGG + Intronic
937295230 2:120806271-120806293 ACCCGGGCCTGGGTGCCTCTGGG + Intronic
1172618121 20:36303154-36303176 ACCTCTGCATGGGTTTCTCTTGG + Intergenic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
963328894 3:143892423-143892445 TCCTGCTCCTGGGTTTCTCTGGG + Intergenic
968693288 4:2008115-2008137 CCTCACGCGGGGGTTTCTCTCGG + Intronic
983577838 4:169277288-169277310 GCCAGCGTGTGTGTTTCTCTGGG - Intergenic
1017158094 6:151340700-151340722 ACCTGCTCGTGGGTTTGGCTTGG - Intronic
1021917960 7:25454699-25454721 AGCCTCTCCTGGGTTTCTCTCGG + Intergenic
1057028266 9:91753576-91753598 ACCTGTGGCTGGGTTTCTCTAGG - Intronic
1062022828 9:134327174-134327196 ACCCGGGCGTGGGCTGCTTTGGG - Intronic