ID: 1117913022

View in Genome Browser
Species Human (GRCh38)
Location 14:60652451-60652473
Sequence CCCGAGCCGCGCTGCAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117913022_1117913031 19 Left 1117913022 14:60652451-60652473 CCCTCGCTGCAGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1117913031 14:60652493-60652515 GAGCGCCCGATGCCAGGTTTCGG 0: 1
1: 0
2: 0
3: 1
4: 49
1117913022_1117913030 13 Left 1117913022 14:60652451-60652473 CCCTCGCTGCAGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1117913030 14:60652487-60652509 GGCAAGGAGCGCCCGATGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 107
1117913022_1117913027 -8 Left 1117913022 14:60652451-60652473 CCCTCGCTGCAGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1117913027 14:60652466-60652488 GGCTCGGGAGGGAACACCGCTGG 0: 1
1: 0
2: 0
3: 13
4: 124
1117913022_1117913028 -3 Left 1117913022 14:60652451-60652473 CCCTCGCTGCAGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1117913028 14:60652471-60652493 GGGAGGGAACACCGCTGGCAAGG 0: 1
1: 0
2: 1
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117913022 Original CRISPR CCCGAGCCGCGCTGCAGCGA GGG (reversed) Intronic
900625920 1:3608521-3608543 CCCGACCCGCCCTGGAGGGAAGG + Intronic
901242733 1:7704522-7704544 CCCGAGCCGCGCTGGACGGCGGG - Intronic
902067511 1:13700359-13700381 CCCGAGGAGCGCGGCGGCGACGG + Intronic
902323592 1:15684364-15684386 TCCGGGCCGCGGTGGAGCGAGGG + Exonic
904237240 1:29123515-29123537 CCCGCGCGTCGCTGCCGCGAGGG + Intronic
912798496 1:112706870-112706892 CCCTCCCCGGGCTGCAGCGAGGG - Intronic
918793209 1:188857928-188857950 CCCGAGCCTCCCCGCAGCGTGGG + Intergenic
1064179027 10:13099447-13099469 CCCGGGTAGCGCTGCAGGGATGG - Intronic
1065844692 10:29735451-29735473 CCCGAGGCGCGCTCCGGGGACGG + Intronic
1069588966 10:69630344-69630366 CCCGGCCCGGGCTGCAGCGAGGG - Intronic
1069927148 10:71858661-71858683 CCCATACCGCGCTGCAGGGACGG + Intergenic
1070895831 10:79982327-79982349 CTCGGGCGGCGCTGCTGCGAAGG + Intronic
1071788689 10:88931866-88931888 ACTGAGCTGCGCTGCAGCAATGG + Intronic
1078354905 11:10626158-10626180 CCCGGCCCCCGCTGCTGCGAGGG - Exonic
1083883215 11:65558373-65558395 GCCGCGCCGCGCTCCAGCCAGGG - Intronic
1086322445 11:85664752-85664774 CCTGACCCGGGCTGCAGCGGGGG - Exonic
1090799210 11:130160107-130160129 CCAGCGCCGCGCTGCAGGGTCGG - Intronic
1105004322 12:132711332-132711354 CCCGGCCCGCGCTCCGGCGATGG - Intronic
1110596541 13:77326620-77326642 CCCCAGCCCCGCAGCAGCCACGG + Exonic
1113942488 13:114025503-114025525 CCCGACCTGCCCTGCAGAGAGGG - Intronic
1117913022 14:60652451-60652473 CCCGAGCCGCGCTGCAGCGAGGG - Intronic
1119320699 14:73728511-73728533 CCAGAGCTGAGCCGCAGCGATGG - Intronic
1119786873 14:77320793-77320815 CCCGCGCTCCGCTGCAGTGAAGG - Exonic
1121352599 14:93185161-93185183 CCCCTGCCGCGCTGCAGCGCCGG - Exonic
1122602938 14:102930296-102930318 CCCGCGCGGCGCAGCAGCGGCGG - Exonic
1122938922 14:104972612-104972634 CACTGGCCGCACTGCAGCGAGGG - Intronic
1122961137 14:105094018-105094040 CCGGAGCCGCGAAGCCGCGATGG + Intergenic
1132644369 16:992003-992025 CCCGAGCTGGGCTGTAGGGAGGG + Intergenic
1136110914 16:28063285-28063307 CCCAAGCCGGGCTGCGGCCAGGG - Exonic
1136141631 16:28292515-28292537 GCGGAGCCGCGATGCCGCGATGG + Exonic
1143450922 17:7036283-7036305 CCCGAGCCACCCGGCAGCGGGGG + Exonic
1146797833 17:35795385-35795407 CCCGAGCCGGGCTGCACCGGAGG - Exonic
1152270780 17:79323615-79323637 CCCAAGCCTCCCTGCAGCGGGGG + Intronic
1152817119 17:82414626-82414648 TCCCAGCCGCGCCGCAGGGAGGG - Intronic
1157849026 18:51030419-51030441 CCCGGGCCGCCCTGCGGCGGGGG - Exonic
1160960607 19:1719050-1719072 CCCCAGCCCCGCTGCGGCGGCGG - Intergenic
1161450741 19:4344010-4344032 CCCGAGCCGCGATGGGACGAGGG - Intronic
1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG + Exonic
1163008465 19:14410579-14410601 CTCGAGCCACGCTTCAGGGAGGG + Intronic
1164692668 19:30222705-30222727 CCTGGGGCGCGCTGCCGCGAGGG - Intergenic
1165255974 19:34577501-34577523 CCCGGGCCGCGCTGCAGCCCCGG - Intergenic
1166759793 19:45217596-45217618 TCCGCGCCGAGCTGCAGCGCAGG + Exonic
1167637317 19:50662428-50662450 TCCGAGGCGGGCAGCAGCGAGGG + Exonic
925959568 2:9003212-9003234 TCCGAGCGCCGCTGCCGCGAAGG + Intronic
927606608 2:24491650-24491672 CACGAGCCGCGCGGCCGCGGAGG + Intergenic
927965354 2:27264551-27264573 CCCGTGCCGCTCTGCAGCAGCGG - Intronic
931681290 2:64751471-64751493 CCCGAGCCGCGCGGGAGGGGAGG - Intergenic
947795965 2:232894204-232894226 CCTGGGCCGAGCTGCAGCGGAGG - Intronic
1169204664 20:3732925-3732947 CCGCAGCCACGCTGCAGAGAGGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1175282212 20:57811473-57811495 TCCCAGCCGCCCTGCAGCTAGGG - Intergenic
1180058098 21:45369675-45369697 AACAAGCCGCGCTGCAGGGATGG - Intergenic
1181510778 22:23387912-23387934 CTGGAGCCGGGCTGCAGCGCAGG - Intergenic
1182547513 22:31084689-31084711 CCCGAGCCTCGCTTAAGAGAGGG - Intronic
1185278782 22:49961108-49961130 CCCGCGCCTCCCTGCAGCCAAGG + Exonic
1185375526 22:50481302-50481324 CCAGAACCCCGCTGCAGCGTGGG + Intergenic
952843467 3:37667575-37667597 CCTGAGCTGCGCTGGAGCCAGGG - Intronic
964570356 3:158103511-158103533 CCCGAGCCCAGGGGCAGCGAGGG - Intronic
964786151 3:160399007-160399029 CCGGAGCCCCGCTGCCGCCAGGG + Intronic
968506426 4:973305-973327 CCCGGGCCCCGCTGCCGCGCCGG - Exonic
968611642 4:1559896-1559918 CCTGGGCCGCCGTGCAGCGATGG + Intergenic
969285611 4:6200269-6200291 CCCGAGCCGGGCAGCAGCAGCGG + Exonic
985541956 5:491529-491551 CCCAAGCCGAGCTGCCGAGATGG + Intronic
996185167 5:120465165-120465187 CTCGAGCCTCGCTGTAGGGAAGG + Intronic
1002763575 6:219871-219893 CCCGAGCAGCCCTGCAGATATGG + Intergenic
1004193963 6:13487667-13487689 GGCGCGCGGCGCTGCAGCGAGGG - Intergenic
1006933084 6:37699006-37699028 CCCGAGCCCCGCTCCAGCGGCGG + Intronic
1007371243 6:41428085-41428107 CCCGAGCCGCCCTGGCGCGCTGG - Intergenic
1011128729 6:84033683-84033705 CCGGAGCAGGGCTGCAGCGCGGG - Intergenic
1019197166 6:170289624-170289646 CCCGAGCCGCCCTGCACCTACGG - Exonic
1024930687 7:54664490-54664512 CCAGAGCTGAGCTGCAGCGGTGG - Intergenic
1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG + Exonic
1034197910 7:149262259-149262281 CCGGGGCGGCGCGGCAGCGACGG - Exonic
1037772183 8:21808784-21808806 CCCGAGCTGCGTTTCAGTGAAGG + Intronic
1051780550 9:20684319-20684341 CCCGAGCAGGGGTGCAGCGGTGG - Intronic
1056381013 9:86057506-86057528 CCCGAGCCGGGGTGCAGCTGAGG + Intronic
1057299648 9:93870515-93870537 CCCCAGCCGCACTGCAGCCCTGG + Intergenic
1062065213 9:134523084-134523106 CCCTGGCCACGCTGCAGAGAGGG - Intergenic
1187547307 X:20266708-20266730 CCCGAGCCCCACGGCAGCGGCGG + Exonic
1189322759 X:40096578-40096600 CCCGAGTTGCGCGGCAGCGGCGG + Intronic
1190246857 X:48696617-48696639 ACCGAGCCGGGCGGCAGGGAGGG + Intronic
1192234871 X:69289377-69289399 CCCAAGCTGGGCTGCAGGGAGGG - Intergenic
1193086034 X:77448298-77448320 CTCGGCCCGCGCTGCAGCCACGG - Intronic