ID: 1117913374

View in Genome Browser
Species Human (GRCh38)
Location 14:60654667-60654689
Sequence AAGCAGTGATACCTGGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117913374_1117913378 10 Left 1117913374 14:60654667-60654689 CCACTACCCAGGTATCACTGCTT 0: 1
1: 0
2: 2
3: 14
4: 127
Right 1117913378 14:60654700-60654722 TTGGTTTATTACTCCTCTGCAGG 0: 1
1: 0
2: 1
3: 9
4: 137
1117913374_1117913377 -9 Left 1117913374 14:60654667-60654689 CCACTACCCAGGTATCACTGCTT 0: 1
1: 0
2: 2
3: 14
4: 127
Right 1117913377 14:60654681-60654703 TCACTGCTTCACTTAAATTTTGG 0: 1
1: 0
2: 0
3: 31
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117913374 Original CRISPR AAGCAGTGATACCTGGGTAG TGG (reversed) Intronic
902400257 1:16153506-16153528 AAGCAGGCATAGCTGGGCAGGGG - Intronic
902823828 1:18959180-18959202 AAGAAGTCACACCTGGGGAGTGG + Intergenic
904926978 1:34057204-34057226 AAGCAGAGAGACCAGGGCAGAGG - Intronic
905242271 1:36588785-36588807 AAGCAGAGCTTCCTGGGCAGGGG + Intergenic
907693818 1:56700571-56700593 CAGCAGTGAAAGCTGGGTAAAGG - Intronic
917084211 1:171289724-171289746 AAGCAGGGAGACAGGGGTAGAGG - Intergenic
917508405 1:175649622-175649644 AAGAAGTGATGCCTGGGTGAAGG - Intronic
918037684 1:180891563-180891585 AGGCAGTGATACCTAGTAAGAGG - Intergenic
920457146 1:206110022-206110044 CAGCTGTGACACCAGGGTAGGGG + Exonic
921108843 1:212012970-212012992 AAGCACTGACACCTTGGCAGTGG + Intronic
923183098 1:231542084-231542106 GAGCAGTGATCCCTGGGGAAAGG - Intronic
923503166 1:234583035-234583057 AAGCACTGATTCCTTGGTTGGGG - Intergenic
1065225049 10:23534995-23535017 ATGGAGTAATACCTAGGTAGAGG + Intergenic
1071847365 10:89534951-89534973 AACCAGTGATACCTGTATTGTGG - Intronic
1074053279 10:109899302-109899324 GAGAGGTGATACCTGGGTCGGGG + Intronic
1074160363 10:110831636-110831658 AAGCAGGGATACCTGCATAGGGG - Intronic
1076695558 10:132245772-132245794 AAGCAGCCTTACCTGGGCAGAGG - Intronic
1079646448 11:22869311-22869333 AAGGAGTCACACCAGGGTAGAGG + Intergenic
1081955300 11:47086790-47086812 AAGCAGTGATAACTGTGAAGGGG + Intronic
1084277906 11:68064962-68064984 CAGCACTGAAACCTTGGTAGCGG - Intronic
1085207371 11:74744081-74744103 ATGCAGAGCTATCTGGGTAGAGG + Intergenic
1085454165 11:76656404-76656426 AAGCAGCCTCACCTGGGTAGGGG - Intergenic
1085947984 11:81295455-81295477 AAAAAGTGATATCTGGCTAGTGG + Intergenic
1089507721 11:118975270-118975292 AAGCAGAGGTCCCTGGTTAGTGG + Intronic
1091244362 11:134079136-134079158 AAGCAGTGATTCTTAGGGAGAGG - Intronic
1094762108 12:33545876-33545898 AAGCAGAGAAACCTGTGAAGAGG - Intergenic
1096785013 12:54011950-54011972 AAGCAGGGAGCCCTGGGGAGGGG - Exonic
1097329322 12:58316297-58316319 AAGCAGTGAAAGCGGGGAAGCGG - Intergenic
1102400917 12:112628876-112628898 AAGCAGGGAGACCAGGGAAGAGG + Intronic
1102629298 12:114263348-114263370 AAGCAGATATGCCTGGGGAGTGG + Intergenic
1103266081 12:119631412-119631434 AACCAGTGGCAGCTGGGTAGAGG + Intronic
1104598304 12:130134673-130134695 CAGCAGGGATAGCTGGGTAGTGG - Intergenic
1104772327 12:131371197-131371219 AAGCTGTGGTCCCTGGTTAGCGG - Intergenic
1107078833 13:36352643-36352665 AAGCAGTGAAAACTGAGAAGAGG + Intronic
1108704862 13:52975756-52975778 AACCACTGATACCTGAGCAGTGG + Intergenic
1114808609 14:25869082-25869104 AAGCAGTCATACCACGGCAGTGG - Intergenic
1116101676 14:40446051-40446073 AAGCAGTGATAGAGGAGTAGGGG + Intergenic
1117913374 14:60654667-60654689 AAGCAGTGATACCTGGGTAGTGG - Intronic
1119914128 14:78381113-78381135 AAGTAGTGATACTTAGGTTGAGG - Intronic
1120605488 14:86570862-86570884 AAGCTGTGACACGTGGGGAGCGG - Intergenic
1122319949 14:100848966-100848988 AAGCACAGATACCTGAATAGAGG + Intergenic
1127454365 15:59143829-59143851 TAGCAGTGCTGCCTGGGAAGTGG - Intronic
1128868769 15:71136590-71136612 AAGCACTCATCCCTGGGGAGGGG - Intronic
1137560127 16:49497071-49497093 AAGCAGTGATTTGTGGGTACAGG - Intronic
1139968107 16:70756689-70756711 ACCCAGTGGTACCTGGGTTGAGG - Intronic
1140418506 16:74796028-74796050 AGGCAGTGATCCCTGAGAAGTGG + Intergenic
1147694571 17:42341659-42341681 TAGCAGTGAGGCCTGGGTTGAGG + Intronic
1149288109 17:55188476-55188498 GAACAGTGATACCTGGGAACTGG + Intergenic
1150235476 17:63589507-63589529 AAACAGAGACACCTGGGCAGAGG - Exonic
1150916590 17:69443763-69443785 AAGTAGTGATAAGTTGGTAGGGG + Intronic
1150920068 17:69473463-69473485 TAGCAGTTTTGCCTGGGTAGTGG + Intronic
1152869012 17:82741519-82741541 AAGCTGTGATACCTGGAATGGGG + Intronic
1156538627 18:37888103-37888125 ATGCAGTGGTACCTGGGCAGCGG + Intergenic
1159784065 18:72693076-72693098 AAACAGTGATAGTTGGGTTGGGG - Intergenic
1161534936 19:4813145-4813167 CAGAAGTGAAACCTGGGGAGTGG - Intergenic
1163111583 19:15164452-15164474 AATCACTGGAACCTGGGTAGTGG + Intronic
1163668694 19:18614908-18614930 CAGCAGTGAAAGCTGGGAAGGGG - Intronic
1164711029 19:30357379-30357401 AGACAGTGATCCCTGGGGAGAGG + Intronic
927384906 2:22521740-22521762 AAGCAGTGACCCCTGGGGAGGGG - Intergenic
930144864 2:47991680-47991702 AAGCAGTGCTGCCTGGTTAATGG + Intergenic
930740021 2:54822738-54822760 AAGCAGTTATCTCTGGGTAATGG + Intronic
932467074 2:71930806-71930828 GAGGAGTGATACCTGGGGAGAGG + Intergenic
933031233 2:77331376-77331398 AAGCAGTGTTGCTGGGGTAGTGG + Intronic
935145260 2:100391161-100391183 AGGCAGTGACACCAGGGTGGGGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937067332 2:119027452-119027474 AACCAGTGATTGCTGGGTGGTGG - Intergenic
937687821 2:124718264-124718286 AAGCTGTTCTATCTGGGTAGAGG + Intronic
940346785 2:152636902-152636924 AAGCAGTGTTTCCTGTGTAGTGG + Intronic
946109344 2:217400588-217400610 AACAAGTGCTACCTGGGTGGTGG - Intronic
948229714 2:236341174-236341196 AAGCAGCGATTCCTTGGCAGAGG + Intronic
949001442 2:241616407-241616429 AAGCAGTGGCACCTGAGCAGGGG + Intronic
1169953101 20:11069956-11069978 AAGCAGTGGTACCTGTGAAAAGG - Intergenic
1170128472 20:12991771-12991793 AAGCACTTATACTTGGGTATTGG - Intergenic
1170989156 20:21286380-21286402 AAGCAGAGAGACCTGTGTGGTGG - Intergenic
1171078967 20:22158329-22158351 AAGCAGTGTTCTCTGGGTGGAGG + Intergenic
1171203270 20:23258629-23258651 AGGCAGTCATAGCTGGGAAGGGG + Intergenic
1171987468 20:31670552-31670574 AAACAGTCATTCCTGGGTGGAGG + Intronic
1173228948 20:41179263-41179285 AAGCAGTCACCCCTGTGTAGAGG - Exonic
1173881863 20:46420572-46420594 TAGCAATGTTACCTGGGAAGAGG - Intronic
1174051975 20:47773224-47773246 GAGCTGTGATACCTTGGTGGAGG + Intronic
1174090927 20:48046758-48046780 AATCAGAGACAGCTGGGTAGAGG + Intergenic
1178923775 21:36758641-36758663 ATGCAGAGATTCCTAGGTAGGGG - Intronic
1180842502 22:18965884-18965906 AGGCAGTCAAACCTGGGTTGGGG - Intergenic
1180845663 22:18980256-18980278 AAGCTGTGATACCTGGAATGGGG - Intergenic
1181569393 22:23759756-23759778 ATGGAGTGGTACCTGGGAAGGGG + Intergenic
1185325773 22:50225241-50225263 CAGCAGGGATACTTGGGCAGGGG - Intronic
951955330 3:28247145-28247167 AAGCAGTGATACCTTGTGTGAGG - Intronic
953718920 3:45338539-45338561 AAGCAGAGATGCCTGGGAAAAGG - Intergenic
954548151 3:51456341-51456363 AAGCAGTGAGACTGGGGGAGGGG + Intronic
966704063 3:182891389-182891411 AAGTAATAATATCTGGGTAGAGG - Intronic
967788604 3:193523502-193523524 AATCAGTTATGCCTGTGTAGTGG + Intronic
967939298 3:194754060-194754082 AAACGGTGCTACCTGGGCAGGGG - Intergenic
972096062 4:35348701-35348723 AAACACTTATACCTGGTTAGTGG + Intergenic
972245397 4:37241789-37241811 AAGCTGTGATACCTGGATCCTGG + Intergenic
974683686 4:65195958-65195980 AAGCAGGGAGACATGGGCAGTGG - Intergenic
978730820 4:112024467-112024489 AATCAGTGACACCTGGGTTGGGG + Intergenic
981929455 4:150174105-150174127 AAGCAGTTTTATCTGAGTAGTGG - Intronic
982203430 4:152979422-152979444 AAGCTGTGTTTCCTGGGAAGTGG + Exonic
985230739 4:187813695-187813717 AAACAGTGAGACCTGGGCACAGG + Intergenic
987005169 5:13703158-13703180 AAGCAGTCTGTCCTGGGTAGAGG - Intronic
989806594 5:45615100-45615122 AAGCAGTGAAATCTGGTTACAGG - Intronic
998142532 5:139708358-139708380 AAGCAGGGAGACCTGGGAGGAGG - Intergenic
998538039 5:142952499-142952521 AAGCCTTGATACCTTGGTGGAGG + Intronic
998574644 5:143300624-143300646 CAACAGTGACACCAGGGTAGGGG + Exonic
1002665179 5:180818005-180818027 AACCAGCGACAACTGGGTAGTGG - Intergenic
1003810321 6:9772703-9772725 AGGCAGTGATACCAGGGCACTGG + Intronic
1004411189 6:15382959-15382981 AGGTAGTGTCACCTGGGTAGTGG + Intronic
1006422227 6:33942192-33942214 AAGCAGTGATCCCTGGGTATGGG + Intergenic
1008851106 6:56022898-56022920 AAGCAGTGTGTACTGGGTAGAGG - Intergenic
1013219594 6:108066410-108066432 AGGTAGTGTTAGCTGGGTAGAGG + Intronic
1014145469 6:117993247-117993269 AAGCAGTGATTCGAGAGTAGGGG - Intronic
1016346494 6:143119379-143119401 ATGGGGTGATACTTGGGTAGGGG + Intronic
1018642935 6:165921629-165921651 AGGCAGTGATACCTGGAAAGAGG + Intronic
1022187184 7:27981636-27981658 TAGCAGTGATACCTGGGTGGTGG + Intronic
1023214640 7:37848718-37848740 CAGCAGCTATACCTGGGCAGTGG - Exonic
1026065289 7:67066269-67066291 AAGCAGTGAAGCCTGGGAGGAGG - Intronic
1026711584 7:72745599-72745621 AAGCAGTGAAGCCTGGGAGGAGG + Intronic
1029434128 7:100552535-100552557 AAGAAGTGATACCAGGGGAGAGG - Intronic
1030597377 7:111556141-111556163 AAACAGTGATCCCAGGGGAGGGG + Intronic
1032732517 7:134657652-134657674 AAGCAGTGTCACCTGGGAAGAGG + Intronic
1034583629 7:152068683-152068705 AATCAGTTTTACCTGGCTAGAGG + Intronic
1037238991 8:16755857-16755879 ATGCATTGAAACCTGGGTAATGG + Intergenic
1038875856 8:31548143-31548165 AAGCACTCAAACCTGGGAAGTGG + Intergenic
1039483436 8:37892832-37892854 AGGCAGGAATACCTGGGAAGTGG - Intronic
1039738050 8:40353560-40353582 AATCAGTTATTCCTGGGGAGGGG - Intergenic
1041077472 8:54182231-54182253 AAGAATTGACACTTGGGTAGGGG + Intergenic
1043724354 8:83590766-83590788 AAGCTGTGCCACCTGGGTTGAGG - Intergenic
1045692509 8:104774299-104774321 AAGCAGTGATACCTTAGAGGGGG + Intronic
1046958644 8:120086860-120086882 AAGCAATGAGACCTGGGGACGGG - Intronic
1047025759 8:120822561-120822583 AACCACTGATTCCTTGGTAGAGG - Intergenic
1053021796 9:34700315-34700337 AAGCAGGGAGACCAGGGTGGAGG + Intergenic
1056100166 9:83293455-83293477 AAGCAGTGATTCCTGGGGATAGG - Intronic
1057098060 9:92330323-92330345 AAGAAGAGATACATGGTTAGAGG + Intronic
1061067709 9:128288926-128288948 TCGCAGTGATACTTGTGTAGGGG + Exonic
1062531132 9:137000954-137000976 AAGCAGTGAGACCTCGGGAGCGG + Intergenic
1187270247 X:17774025-17774047 AAGCAGTAATAGATGTGTAGAGG - Intergenic
1187561979 X:20411910-20411932 AAGAGGTGATACCTGAGTCGGGG - Intergenic
1190490702 X:50979798-50979820 AAACAGTGATAGTTGGGTTGGGG - Intergenic
1197165834 X:123376773-123376795 AAGAAGTGAAACCTGGGAAGAGG + Intronic
1197870756 X:131060183-131060205 AAGCAGCTAGACATGGGTAGGGG - Intronic
1200293066 X:154889612-154889634 GAGCAGTGATAACTGGGCCGAGG + Intronic
1200339913 X:155385344-155385366 GAGCAGTGATAACTGGGCCGAGG + Intergenic
1200346557 X:155455344-155455366 GAGCAGTGATAACTGGGCCGAGG - Intergenic
1201890207 Y:18935703-18935725 AGGCACTGAGACCTGGGAAGAGG - Intergenic