ID: 1117918690

View in Genome Browser
Species Human (GRCh38)
Location 14:60705278-60705300
Sequence CTTGATACCCAGTAGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117918683_1117918690 5 Left 1117918683 14:60705250-60705272 CCAGCAGCTTAGATTTCACTGCC No data
Right 1117918690 14:60705278-60705300 CTTGATACCCAGTAGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117918690 Original CRISPR CTTGATACCCAGTAGGGAAG TGG Intergenic
No off target data available for this crispr