ID: 1117918911

View in Genome Browser
Species Human (GRCh38)
Location 14:60707251-60707273
Sequence GTTGTAATGTGGCCAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117918909_1117918911 -10 Left 1117918909 14:60707238-60707260 CCATTTGGATGTAGTTGTAATGT No data
Right 1117918911 14:60707251-60707273 GTTGTAATGTGGCCAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117918911 Original CRISPR GTTGTAATGTGGCCAAAATC AGG Intergenic
No off target data available for this crispr