ID: 1117920236

View in Genome Browser
Species Human (GRCh38)
Location 14:60721530-60721552
Sequence CGTCTGCGAGGGTGACTCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117920229_1117920236 30 Left 1117920229 14:60721477-60721499 CCAGGAGCGCAGAAAGCGCTTTG 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1117920236 14:60721530-60721552 CGTCTGCGAGGGTGACTCACCGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117920236 Original CRISPR CGTCTGCGAGGGTGACTCAC CGG Intronic
903776067 1:25794631-25794653 CCTCCGTGAGGGTGACTCTCAGG + Intergenic
904822615 1:33255852-33255874 CGTCTTCGAGGGAGACCCCCAGG + Intergenic
922982963 1:229843962-229843984 CATCAGCCAGAGTGACTCACAGG - Intergenic
1065718155 10:28594057-28594079 CCTCTGGGAGGGTGACAAACAGG + Intronic
1067904737 10:50278966-50278988 AGTCTCCGAGATTGACTCACTGG - Intergenic
1069717722 10:70531586-70531608 TGGCTGCAAGGCTGACTCACGGG + Intronic
1084609038 11:70189560-70189582 CGTCTGCCTGGGAAACTCACAGG + Intergenic
1085044116 11:73343423-73343445 CGCCTGCCAGGGTTCCTCACCGG - Intronic
1091362326 11:134987456-134987478 GGGCTGTGAGGGAGACTCACAGG - Intergenic
1096586927 12:52628933-52628955 CCTCTGGGAGGGAGACCCACAGG + Intergenic
1104575671 12:129963833-129963855 CTTCTGCCAGAGTGTCTCACTGG + Intergenic
1107728443 13:43323932-43323954 CTTCTGCAAGGGTGATTCCCAGG - Intronic
1116246523 14:42421306-42421328 CGTCTGAGAGGGTGCTTCAGAGG + Intergenic
1117920236 14:60721530-60721552 CGTCTGCGAGGGTGACTCACCGG + Intronic
1137665108 16:50245440-50245462 CCCCTCCCAGGGTGACTCACAGG + Intergenic
1147989760 17:44325428-44325450 GGACGGCGAGGGTGACGCACTGG + Intergenic
1150805873 17:68318598-68318620 TGTCTGCCAGGCTGACTCAGAGG + Intronic
1151820243 17:76493122-76493144 CGTCTTCGCGGCTGAATCACAGG + Intronic
1152365082 17:79850901-79850923 CCTCTGCCTGGGTGGCTCACGGG - Intergenic
1154493157 18:14936604-14936626 GGGCTGTGAGGGAGACTCACAGG + Intergenic
1158277727 18:55786761-55786783 TGGCTGAGATGGTGACTCACTGG + Intergenic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1162948052 19:14055308-14055330 GGTGTGAGAGGGTGACTCAAGGG - Intronic
1163103307 19:15109960-15109982 CCTCAGCGACGGGGACTCACCGG + Exonic
924992355 2:323125-323147 CATCTGGGAAGCTGACTCACAGG - Intergenic
934976982 2:98809551-98809573 CCTCTGCGCTGGTGGCTCACAGG + Intronic
946142359 2:217702550-217702572 CGTCTGCCATGGTGACCCAGGGG + Intronic
949000662 2:241610946-241610968 GGTCTCCGAGGGGGACTCTCAGG + Intronic
1174575240 20:51532620-51532642 CGTCTGCGAGGGTGAGCAACAGG - Intronic
1175462332 20:59160745-59160767 TGTGTCCGAGGGAGACTCACGGG - Intergenic
1175816586 20:61886226-61886248 CTCCTGCCAGGGTGCCTCACTGG + Intronic
1182275404 22:29185325-29185347 CGTGTGTGAGGCTGACTCAGGGG + Intergenic
973229505 4:47825302-47825324 CGCCTGCAAGGGGGACTCCCAGG - Intronic
976784556 4:88803110-88803132 CTGCTGAGAGGGTTACTCACCGG - Intronic
985819381 5:2149288-2149310 CCTCTGCGTGGCTGACTCATTGG + Intergenic
986947040 5:13034283-13034305 ACACTGCGAGTGTGACTCACGGG + Intergenic
989441455 5:41476719-41476741 AGTTTGCTAGGGGGACTCACAGG - Intronic
992643550 5:78791521-78791543 GATCTGGGAGGGGGACTCACGGG - Intronic
1002277090 5:178110986-178111008 AGTCTGGTAGGGTTACTCACTGG - Intergenic
1039781183 8:40787708-40787730 GGTCTACAAGTGTGACTCACAGG + Intronic
1055753989 9:79537688-79537710 CCTCTGCTGGGTTGACTCACAGG - Intergenic
1060058972 9:120441988-120442010 TGTCTTGGAGGGTGATTCACTGG - Intronic
1202298849 Y:23388987-23389009 GGTCTGCTAGGGTGACACCCTGG - Intergenic
1202571960 Y:26281611-26281633 GGTCTGCTAGGGTGACACCCTGG + Intergenic