ID: 1117920308

View in Genome Browser
Species Human (GRCh38)
Location 14:60721760-60721782
Sequence CCCGGCCCTGCGGATTCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117920301_1117920308 -7 Left 1117920301 14:60721744-60721766 CCTTGCCACCCTCTGCCCCGGCC 0: 1
1: 0
2: 7
3: 99
4: 845
Right 1117920308 14:60721760-60721782 CCCGGCCCTGCGGATTCCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 66
1117920297_1117920308 -4 Left 1117920297 14:60721741-60721763 CCCCCTTGCCACCCTCTGCCCCG 0: 1
1: 2
2: 3
3: 81
4: 801
Right 1117920308 14:60721760-60721782 CCCGGCCCTGCGGATTCCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 66
1117920300_1117920308 -6 Left 1117920300 14:60721743-60721765 CCCTTGCCACCCTCTGCCCCGGC 0: 2
1: 0
2: 3
3: 45
4: 470
Right 1117920308 14:60721760-60721782 CCCGGCCCTGCGGATTCCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 66
1117920298_1117920308 -5 Left 1117920298 14:60721742-60721764 CCCCTTGCCACCCTCTGCCCCGG 0: 1
1: 0
2: 3
3: 45
4: 607
Right 1117920308 14:60721760-60721782 CCCGGCCCTGCGGATTCCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 66
1117920296_1117920308 9 Left 1117920296 14:60721728-60721750 CCTGCTCGCGGTGCCCCCTTGCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1117920308 14:60721760-60721782 CCCGGCCCTGCGGATTCCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117920308 Original CRISPR CCCGGCCCTGCGGATTCCGT TGG Intronic
904000593 1:27336337-27336359 CCCTGCTCTGTGGATTCCTTTGG + Exonic
904585922 1:31580558-31580580 CCCGGCCCTGCAGACTCCTCTGG + Intronic
904732832 1:32607476-32607498 TCCAGCCCTGCCGATTCAGTAGG + Intronic
922303461 1:224323780-224323802 CCCTGCCCTGTGGGCTCCGTAGG - Intronic
1068096649 10:52499596-52499618 ACCGGCCCTTCAGATTGCGTGGG - Intergenic
1069597368 10:69681145-69681167 CACGGCCCTGGGGATTCCCCAGG + Intergenic
1076183532 10:128429548-128429570 CCCGCCTCTGCAGATTCCCTGGG - Intergenic
1077368703 11:2171733-2171755 CACGGCCCTGCGGAAGCCCTTGG + Exonic
1091060145 11:132453438-132453460 CCCGGCCCTGGGGATGCCCCTGG - Intronic
1096628585 12:52910766-52910788 CCCAGCCCTGAGGATTCCCCTGG + Intronic
1096741152 12:53695164-53695186 CCGGGCCCTGCGGAGGCCGAAGG - Intergenic
1104602131 12:130161592-130161614 CCCGGCTCTGCGGCTTCGGAGGG + Intergenic
1104752504 12:131248597-131248619 CCCTGCCCTCTGGATTCTGTTGG - Intergenic
1104768829 12:131347176-131347198 CCCAGCCCTGCTCATGCCGTTGG - Intergenic
1104779436 12:131410640-131410662 CCCTGCCCTCTGGATTCTGTTGG + Intergenic
1113438195 13:110308752-110308774 CACAGCCCTGCCGATACCGTGGG + Intronic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1117920308 14:60721760-60721782 CCCGGCCCTGCGGATTCCGTTGG + Intronic
1131395785 15:92084901-92084923 CCTGGCCCTGCGGCTTCTGCAGG - Intronic
1133042156 16:3066474-3066496 CCAGGCCCTGCGCACTCTGTGGG + Intronic
1136287815 16:29254548-29254570 CCCGGCCCTGGGGAGACAGTGGG - Intergenic
1140469681 16:75207060-75207082 CCAGGCCCTGCGGAGGCCGAAGG - Intronic
1142093466 16:88227250-88227272 CCCGGCCCTGGGGAGACAGTGGG - Intergenic
1143508253 17:7381274-7381296 CCCGGCCCTGCGCGCTCGGTGGG - Intronic
1143560046 17:7688351-7688373 CCCGGCTCCGCGGGTTCCGTGGG + Exonic
1145255231 17:21318619-21318641 CCGGCCCCTGCCGATTCCCTGGG - Intergenic
1147754945 17:42761682-42761704 CCCGGCACTGAGGCGTCCGTGGG + Intronic
1148870818 17:50658004-50658026 CCCTGCCCTGCGGAGTCCCTTGG - Intronic
1151719090 17:75845468-75845490 CCAGGCCCTGGGGACTCAGTGGG + Intergenic
1153805351 18:8705478-8705500 CCCGGCCCCGAGGATTCCCGCGG - Intergenic
1154729179 18:18132955-18132977 CCTGGCCTTGAGGATTTCGTTGG + Intergenic
1154753377 18:18465028-18465050 CCTAGCCCTGAGGATTTCGTTGG + Intergenic
1154863531 18:19981109-19981131 CCTGGCCTTGAGGATTTCGTTGG + Intergenic
1154877016 18:20166985-20167007 CCTGGCCTTGAGGATTTCGTTGG + Intergenic
1158670529 18:59469892-59469914 CCAGCCTCTGCGGATTCCCTCGG + Intronic
1161387566 19:4004397-4004419 TCCGGCCCTGCTGATTCTGCGGG - Intergenic
1161702886 19:5804856-5804878 CCCGGCCCCGGGGACTCCGACGG - Intergenic
1161777842 19:6273430-6273452 CCCGGCGCTGCGGATTCATGAGG + Intronic
1163743901 19:19033529-19033551 CGCGGCGCTGCGGAGACCGTTGG - Intronic
927997168 2:27494635-27494657 CCCCCCCCAGCGGACTCCGTGGG - Exonic
1168760562 20:347289-347311 CCCGCCCCTGCTGCTTCCCTGGG - Intronic
1175061543 20:56248174-56248196 CCTGGCCCTGAGGATTCTGCAGG - Intergenic
1175248326 20:57594418-57594440 TCCTGCCCTGCGAATTCTGTGGG + Intergenic
1175787713 20:61722603-61722625 CCCTGCCCTGCAGAGTCCTTGGG - Intronic
1179427756 21:41295454-41295476 CTCGGCCCTGGGGATTCAGTTGG + Intergenic
1180144289 21:45910690-45910712 CCCGGCCCTGTGCCTTCCCTCGG - Intronic
1181954937 22:26581319-26581341 CCCAGCCCTGCACATTCCATGGG - Intronic
1182718118 22:32376389-32376411 CCCAGCCCTGCGGAATTTGTGGG - Intronic
950967675 3:17157086-17157108 CCCGGCCCAGAGGAGTCCCTCGG - Intergenic
953289724 3:41649352-41649374 CCCTGCCCTGCTGACTCAGTAGG - Intronic
954304541 3:49718532-49718554 CCCGGCCATGCGCATTGCCTGGG - Exonic
961683278 3:128613058-128613080 CCTGGCCCTGGGGATACAGTCGG - Intergenic
982630530 4:157824281-157824303 ACCTGCCCTTCGGATTGCGTGGG + Intergenic
985548946 5:523777-523799 CCCGGCCCCGGGGACTCCCTGGG + Intronic
986254623 5:6091873-6091895 CCCAGCGCTTCTGATTCCGTTGG - Intergenic
1002066340 5:176653848-176653870 CCAGGCCCTGAGGATTCGGCGGG + Intronic
1002440056 5:179259563-179259585 CTCTGCCCTGGGGATGCCGTCGG - Intronic
1003904804 6:10689335-10689357 CCCTGCCTTGCGGATACCATCGG - Intronic
1019352540 7:561778-561800 CACGGCCCAGCAGCTTCCGTGGG + Intronic
1019527614 7:1487720-1487742 CCCCGCCCTGCGCCTGCCGTCGG - Intronic
1019606728 7:1913773-1913795 GCAGGCCGTCCGGATTCCGTGGG + Intronic
1019624829 7:2010822-2010844 CCCGGCCCTGCGCATGCCCCTGG - Intronic
1020117175 7:5482303-5482325 CCTGGCCGTGGGGCTTCCGTGGG - Intronic
1026833576 7:73624075-73624097 CCCGGTCCTGCGGCTCCCGGAGG - Intronic
1035543845 8:463555-463577 CCTGGCCCTGCAGAGTCGGTGGG - Intronic
1036766950 8:11555378-11555400 CCCGGCCCCGCAGAATCCCTGGG + Exonic
1039123548 8:34175514-34175536 ACCGGCCCTTCGGTTTCCGTGGG + Intergenic
1043502895 8:80874115-80874137 CCCGGCCCTGCGGCCACCGGCGG - Intronic
1049535350 8:143177954-143177976 CCCGCCCCCGCGGCTTCCCTGGG + Intergenic
1057003352 9:91533442-91533464 CCCGGCCCTGCAGATAGAGTGGG + Intergenic
1062592264 9:137279657-137279679 CTCGGCACTGCGGAAGCCGTCGG - Exonic