ID: 1117920543

View in Genome Browser
Species Human (GRCh38)
Location 14:60722788-60722810
Sequence CCCGCAGAGACTGCCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117920543_1117920549 -9 Left 1117920543 14:60722788-60722810 CCGGCGCCGGCAGTCTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1117920543_1117920552 2 Left 1117920543 14:60722788-60722810 CCGGCGCCGGCAGTCTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1117920552 14:60722813-60722835 TCGGGCGGCAGGGAGAGCTACGG 0: 1
1: 0
2: 0
3: 12
4: 113
1117920543_1117920550 -8 Left 1117920543 14:60722788-60722810 CCGGCGCCGGCAGTCTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1117920543_1117920553 8 Left 1117920543 14:60722788-60722810 CCGGCGCCGGCAGTCTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1117920553 14:60722819-60722841 GGCAGGGAGAGCTACGGTGCCGG 0: 1
1: 0
2: 0
3: 63
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117920543 Original CRISPR CCCGCAGAGACTGCCGGCGC CGG (reversed) Intronic
900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG + Intergenic
900782556 1:4627527-4627549 CCTGCAGAGGCTGCCCCCGCTGG - Intergenic
900978941 1:6035387-6035409 CGCGTAGAGTCTGCCGGCGGGGG + Intronic
900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG + Intronic
904612694 1:31734019-31734041 TCCGCAGAGACAGCCGGGGGAGG + Intronic
904720087 1:32500928-32500950 CGCGCAGAGACAGCAGCCGCCGG + Intronic
904783000 1:32964593-32964615 GCCGCAGCGGCGGCCGGCGCCGG - Exonic
907249371 1:53127948-53127970 CCCGCCCAGACTGCTGGCCCAGG + Intronic
915279683 1:154813970-154813992 CACACAGAGACTGCCAGGGCTGG + Intronic
915506051 1:156357135-156357157 CCGGCAGAGAGTGCCGGAGGGGG + Intronic
918198299 1:182243178-182243200 CCCACAGAGTCTGCCAGCACTGG + Intergenic
1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG + Intronic
1067037882 10:42932966-42932988 CCCGCTGAGACTGGGGGCGCGGG - Intergenic
1069858196 10:71453350-71453372 TCTGCAGAGACTGCCGATGCGGG - Intronic
1073446582 10:103584585-103584607 GCCGCAGCGACGGCCGCCGCAGG - Exonic
1077231107 11:1458559-1458581 CCCCCAGAGACTGCGGCCGAGGG + Intronic
1077495688 11:2885590-2885612 CACGCAGAGTCGGGCGGCGCGGG - Exonic
1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG + Intergenic
1084785368 11:71438826-71438848 CCCCCAGAGCCTGCCGGCATCGG + Intronic
1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG + Intronic
1091685065 12:2555659-2555681 CCCGCAAAGACTGCCTGTGAGGG - Intronic
1093736375 12:22625153-22625175 GCCGCAGAGCATGCCGGGGCTGG - Exonic
1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG + Intronic
1097850247 12:64404395-64404417 CTCCAAGAGACTGCTGGCGCCGG + Exonic
1104674783 12:130705087-130705109 CCCCCAGAGGCAGCCGGTGCTGG - Intronic
1104841660 12:131828691-131828713 CCCGCGGAGACCCCCGGCTCCGG - Intronic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1113921813 13:113917596-113917618 CCCGCAGAGACAGCAGGCAGGGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122152211 14:99731350-99731372 CCCCCAGTGACTGCCGGGGAGGG - Intergenic
1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG + Intronic
1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG + Exonic
1129329787 15:74821118-74821140 CCCGCAGAGCCTGCAGGATCCGG - Exonic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1132855975 16:2044707-2044729 CATGCAGCGACTGCGGGCGCGGG - Exonic
1133053837 16:3135024-3135046 CCCGCGAGGACTTCCGGCGCCGG + Exonic
1136074683 16:27808824-27808846 CCCGCAGAGGCTGCTCGCTCTGG - Intronic
1136414533 16:30095544-30095566 CCCGGAGAGGCTGCTGGCTCTGG - Exonic
1142367810 16:89659309-89659331 CCCGCAGAGCCTGCCGTCCGAGG + Intronic
1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG + Intronic
1146061697 17:29611268-29611290 CCCACAGTGCCTGCCGGGGCAGG + Intronic
1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG + Exonic
1150840379 17:68601010-68601032 CCCGCGGTGGCAGCCGGCGCCGG - Exonic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1152139046 17:78525687-78525709 CACGCAGGGACTGCCTGCTCTGG + Intronic
1152743774 17:82030091-82030113 CAAGCTGAGACTGCTGGCGCAGG + Exonic
1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG + Intergenic
1153759404 18:8316206-8316228 CCAGTAGAGACTGCAGGAGCTGG - Intronic
1154107438 18:11534536-11534558 CCTGCAGAGACTGCAGGAGAAGG - Intergenic
1157689197 18:49667181-49667203 CCCTCGGAGGCTGCCGGTGCTGG + Intergenic
1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG + Exonic
1157894274 18:51449095-51449117 CGTGCAGAGACTCCCCGCGCAGG + Intergenic
1160868805 19:1267779-1267801 CCCGCATGGACGGCGGGCGCAGG + Intronic
1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG + Intronic
1165173187 19:33907264-33907286 CCCGCAGAAACCGCGGGCACTGG + Intergenic
1165385964 19:35510848-35510870 GCTGGAGAGACTGCCGGCTCTGG + Intronic
1166214465 19:41326157-41326179 GCCGCAGACACAGCCTGCGCTGG + Intronic
1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG + Exonic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1168058935 19:53879676-53879698 CCGGAAGAGACTGACCGCGCCGG + Intronic
926311599 2:11679720-11679742 CGCACAGAGACTGCCGGGGCAGG - Intronic
932440371 2:71731085-71731107 CCCGCAGGGGCGCCCGGCGCCGG - Intergenic
932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG + Exonic
934613774 2:95758898-95758920 CTCCCAGGGACTGCCGGCACAGG + Intergenic
934840502 2:97621337-97621359 CTCCCAGGGACTGCCGGCACAGG - Intergenic
936152377 2:110028802-110028824 CCAGCAGAGAGTGCCAGAGCTGG + Intergenic
936192302 2:110342610-110342632 CCAGCAGAGAGTGCCAGAGCTGG - Intergenic
938383985 2:130851797-130851819 CCCGGAGAGACTGGCAGAGCAGG - Intronic
947985303 2:234442457-234442479 ACAGCAGAGACTGCAGGCCCAGG - Intergenic
948394168 2:237632345-237632367 CCCGCAGAGAGCTCCGGAGCAGG - Intronic
948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG + Intronic
948570114 2:238912562-238912584 CCCGGAGAGGCGGCCGCCGCAGG - Intergenic
1180108600 21:45637034-45637056 CCGGCACAGACTGCGGGTGCAGG - Intergenic
1183856205 22:40636668-40636690 ACCACAGACACTGCCGCCGCCGG + Exonic
1184270776 22:43381671-43381693 TCCGCAGAGAGTGCTGGAGCTGG + Intergenic
1185088128 22:48751731-48751753 CTGGCAGAGGCTGCCGGCCCGGG - Intronic
959159201 3:102703546-102703568 CCTGCAGAGACTGCCCTAGCAGG - Intergenic
975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG + Exonic
976246767 4:83012708-83012730 CCCGCTGCGAGTGCCTGCGCGGG - Intronic
1003236969 6:4303395-4303417 CCAGCAGAGACTGTTGGGGCTGG - Intergenic
1006116075 6:31776840-31776862 CCCGCAGAGCCGGCCTGCCCTGG - Intronic
1013226649 6:108123744-108123766 AGAGCAGAGACTGCCGGTGCTGG + Intronic
1013575720 6:111482641-111482663 TCCACGGAGACGGCCGGCGCCGG + Intronic
1017731723 6:157323259-157323281 CCCGCGGAGTCTGGCGGCCCAGG - Intronic
1018734790 6:166679722-166679744 CCAGCAGAGAGAGCCGGCTCCGG - Intronic
1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1021902379 7:25298862-25298884 CCAGCAGAGACTGCCGTCATAGG + Intergenic
1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG + Exonic
1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG + Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034845441 7:154440257-154440279 ACTGCAGAGACTGCAGGCGTGGG - Intronic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1035237458 7:157508179-157508201 ACCGCAGGGACTGCCTGGGCGGG + Intergenic
1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG + Exonic
1039593589 8:38770765-38770787 ACCGAAGAGACTCCTGGCGCTGG - Intronic
1042903073 8:73747110-73747132 CCCGCAGAGCCTGCAGCTGCTGG - Intronic
1049380739 8:142314562-142314584 CCAGAAGAGGCTGCCGGGGCCGG + Intronic
1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG + Intergenic
1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG + Exonic
1057307720 9:93921779-93921801 CCCTGAGAGGCTGCCGGGGCTGG - Intergenic
1061029005 9:128068423-128068445 CCCGCAGATAGCGCCGCCGCAGG - Exonic
1061850115 9:133409948-133409970 CCCTCAGAGACTGCTGCCGTGGG - Intronic
1062347476 9:136122037-136122059 CGAGCAGAGACTGGCGGGGCAGG - Intergenic
1186426106 X:9465255-9465277 CCCGGAGAGAGCGCGGGCGCTGG - Exonic
1198398802 X:136250830-136250852 CCCGCAGGGACTCCGCGCGCCGG - Intronic