ID: 1117920549

View in Genome Browser
Species Human (GRCh38)
Location 14:60722802-60722824
Sequence CTCTGCGGGCCTCGGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117920543_1117920549 -9 Left 1117920543 14:60722788-60722810 CCGGCGCCGGCAGTCTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1117920539_1117920549 -3 Left 1117920539 14:60722782-60722804 CCCCGGCCGGCGCCGGCAGTCTC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1117920540_1117920549 -4 Left 1117920540 14:60722783-60722805 CCCGGCCGGCGCCGGCAGTCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1117920534_1117920549 23 Left 1117920534 14:60722756-60722778 CCGGTGTGACCTCGCGGAGGTGC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1117920533_1117920549 24 Left 1117920533 14:60722755-60722777 CCCGGTGTGACCTCGCGGAGGTG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1117920535_1117920549 14 Left 1117920535 14:60722765-60722787 CCTCGCGGAGGTGCAGACCCCGG 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1117920530_1117920549 29 Left 1117920530 14:60722750-60722772 CCAGGCCCGGTGTGACCTCGCGG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1117920541_1117920549 -5 Left 1117920541 14:60722784-60722806 CCGGCCGGCGCCGGCAGTCTCTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117920549 Original CRISPR CTCTGCGGGCCTCGGGCGGC AGG Intronic
900349524 1:2228101-2228123 CTCTGAGGGCCGCGGGCGAGAGG + Intergenic
900351630 1:2237851-2237873 CCCTGAGGGCCCCGGGAGGCTGG + Intronic
900380447 1:2381514-2381536 GTGTGCGGGCCTCGGTTGGCAGG + Intronic
900438384 1:2641948-2641970 CTCTGCAGGGCAGGGGCGGCCGG - Intronic
900550531 1:3252289-3252311 CTGTGCGGGCATTGGGGGGCTGG + Intronic
901007839 1:6180258-6180280 GGCTGCGGGACTCGGGCTGCGGG - Intergenic
902406688 1:16187919-16187941 CTCTGCCGCCCTCTGGTGGCTGG + Intergenic
902410227 1:16207848-16207870 CCCTGACGGCCTCAGGCGGCCGG + Intronic
902691012 1:18110091-18110113 CTCTGCGGGCTGCGGGAGGCGGG + Intronic
903172471 1:21562796-21562818 CTCTCCGGGCCTGGGGCTGCAGG - Intronic
903173753 1:21568929-21568951 GCCTGCGGGCCTGGGGCAGCTGG + Intronic
904273539 1:29365981-29366003 CTCTGCAGGCCTCAGGCCACTGG + Intergenic
905639091 1:39576428-39576450 CTCGGCGAGCCCCGGGCGGGCGG + Intronic
905670703 1:39788584-39788606 CTCGGCGGGCGGCGGGCGGCGGG + Exonic
905819801 1:40980268-40980290 CAGTGCGGGCCTCGGGCCTCCGG + Intronic
906530948 1:46523731-46523753 CTCTGCAGGCCCCTGGTGGCTGG - Intergenic
910030086 1:82709258-82709280 CTCTGCGGGGCTGAGGCGGGTGG - Intergenic
919103504 1:193121969-193121991 CTCCGCGGGCAGCCGGCGGCGGG + Intergenic
920002197 1:202807837-202807859 CGCCGCGGGGCTCGGGCGGCCGG - Intronic
921039540 1:211416675-211416697 CGCCGGGGGCCCCGGGCGGCCGG + Intergenic
922669094 1:227495146-227495168 CACTGCTGGACTAGGGCGGCAGG + Intergenic
922670503 1:227506156-227506178 CACTGCTGGACTAGGGCGGCAGG - Intergenic
1065101380 10:22335688-22335710 CTCCCCGGGTCTCGGGCCGCGGG - Intergenic
1067700496 10:48568108-48568130 CTCTGGGGACCTTGGGCTGCTGG + Intronic
1070665746 10:78342274-78342296 CTCTTCAGGCCTTGGGAGGCTGG + Intergenic
1072294096 10:93993589-93993611 CTCTGCACACCTCAGGCGGCGGG - Intergenic
1075322008 10:121499026-121499048 CTCTAAGGGCCTCGAGGGGCTGG - Intronic
1075532342 10:123240335-123240357 CTGTGCTGGCCTCGGGCGCAGGG + Intergenic
1075619238 10:123913768-123913790 CTCTGCGGACCTGGAGCTGCTGG - Intronic
1076166596 10:128287015-128287037 GTCTGCGGGCCGCGGGCCGCGGG - Intergenic
1076690839 10:132223224-132223246 CTCTGCTGTCCTCTGGCGCCAGG - Intronic
1076787904 10:132760192-132760214 CTTTGAGGGCCTGGGGCTGCTGG - Intronic
1076930664 10:133529707-133529729 CTCTGCGGGGCGCGGGCTGGTGG + Intronic
1077014137 11:392560-392582 CTGTGGGGGCCTCGGAGGGCGGG - Intergenic
1077368145 11:2169530-2169552 CTGTGCCGGCCTCGGGGGCCTGG + Intronic
1077433329 11:2526660-2526682 CTCTGGGGGCCTGGGGAGGGTGG + Intronic
1077914722 11:6603805-6603827 CTCACCGGGACTCGGGCTGCAGG - Exonic
1078060419 11:8039446-8039468 CTCTGTGGGCCCCGGATGGCAGG - Intronic
1078895640 11:15594726-15594748 CTCTGGGGGGCTGGGGCTGCAGG - Intergenic
1080225512 11:29955914-29955936 CTTTGGGAGCCTGGGGCGGCTGG + Intergenic
1080606812 11:33870441-33870463 CTCTGCGGGCTGCGGGCTACGGG + Intronic
1081845789 11:46239300-46239322 CTCTGCCGGCCGCGCGGGGCAGG - Intergenic
1083920841 11:65780850-65780872 CGGTGCGGGCCGCGGGCGGGAGG - Intergenic
1084336597 11:68461175-68461197 GACTGCGGGCCGCGGCCGGCGGG - Intronic
1084363795 11:68684983-68685005 CTCTGCGGGGCTCTGGTCGCCGG + Exonic
1084604212 11:70162869-70162891 CTCTGGGGACCTTGGGCAGCTGG - Intronic
1085396069 11:76207789-76207811 CTCCGCGGGCTGCGGGCGGGCGG - Intronic
1089515695 11:119030294-119030316 CCCGGCGGGCTTCGGGCTGCAGG + Intronic
1089677319 11:120098633-120098655 CTCTGAGGGCTTGGGGTGGCAGG - Intergenic
1091550323 12:1531074-1531096 GTCTGCGCGCCGCGGGCGTCGGG + Intronic
1091584052 12:1805885-1805907 CTGGGCGGGCCGCAGGCGGCAGG + Intronic
1095206162 12:39442895-39442917 GTCTGCCGGCGGCGGGCGGCGGG - Intronic
1100315465 12:93441460-93441482 CGCGGCGGGGCTCGGGCGCCTGG - Intronic
1102144681 12:110645909-110645931 CTCTGCTGGCCTCGGTGGGAGGG - Intronic
1103321941 12:120097183-120097205 CTCCGTGGGCCTCGGGCTGGGGG + Exonic
1103323395 12:120104471-120104493 TTCTGCCTGCCTTGGGCGGCAGG - Intronic
1103400752 12:120641236-120641258 CTCTGCGAGCCCGGGGCCGCGGG + Exonic
1103800313 12:123533614-123533636 CGCAGCGGGCAGCGGGCGGCGGG + Exonic
1103856461 12:123973559-123973581 CCCCTCGGGCCTCGGGCGGTCGG + Exonic
1104900698 12:132188260-132188282 CTCTGGGGGCCTGCAGCGGCAGG - Intergenic
1105071416 12:133236142-133236164 CTCTGCGGGGCGCGGGGTGCGGG + Intergenic
1106463606 13:29993812-29993834 CTCTCCGGGCCTCTGCCGTCTGG - Intergenic
1108541704 13:51452358-51452380 CCCGGCGGCCCGCGGGCGGCAGG - Intronic
1110450838 13:75636243-75636265 CTCGGCGGGCCCCGGGAGGGCGG + Intronic
1113955653 13:114098953-114098975 GTCTGGGGGGCTCGGGTGGCCGG - Intronic
1113955668 13:114098991-114099013 GTCTGGGGGGCTCGGGTGGCCGG - Intronic
1113955683 13:114099029-114099051 GTCTGGGGGGCTCGGGTGGCCGG - Intronic
1113955698 13:114099067-114099089 GTCTGGGGGGCTCGGGTGGCCGG - Intronic
1113955713 13:114099105-114099127 GTCTGGGGGGCTCGGGTGGCCGG - Intronic
1113955728 13:114099143-114099165 GTCTGGGGGGCTCGGGTGGCCGG - Intronic
1113955743 13:114099181-114099203 GTCTGGGGGGCTCGGGTGGCCGG - Intronic
1115576245 14:34714680-34714702 CTCGGCGGGCCGCAGGCAGCGGG + Exonic
1115961258 14:38837677-38837699 CTCTGCGGGCCTCAGAGTGCAGG + Intergenic
1117920549 14:60722802-60722824 CTCTGCGGGCCTCGGGCGGCAGG + Intronic
1122626783 14:103089106-103089128 CTCTGAGGGCCACTGGGGGCTGG + Intergenic
1122942081 14:104985965-104985987 CTCTGCGGGCCGCGTGCGAGAGG + Exonic
1129917169 15:79283782-79283804 CACTGTGCGCCTCGGGCGGCGGG - Intergenic
1130886082 15:88093801-88093823 CTCTGTGGGCCTCAAGCGGGGGG + Intronic
1132330564 15:101009447-101009469 CTCTGCAGGACTCTGGCAGCAGG + Intronic
1132498803 16:275789-275811 CCCTCCCGGCCTCGGGCGCCGGG + Intronic
1132508108 16:322653-322675 CTCTGTGGGACTCAGGTGGCTGG - Intronic
1132551386 16:555218-555240 CCGGGCGGGCCTCGGGCGGCGGG + Intergenic
1132668666 16:1093970-1093992 CCCTGCAGGCCCCGGGCGCCTGG + Exonic
1132883210 16:2171383-2171405 CTGTGGGGGCCTCTGGCAGCAGG - Intronic
1133232022 16:4371491-4371513 CTCTGCGGCCCTGGAGAGGCAGG - Intronic
1134024191 16:10942053-10942075 CGCTGCGGCGCCCGGGCGGCCGG + Exonic
1134847077 16:17449197-17449219 CTCAGCTGGCCTGGGGCAGCAGG - Intronic
1135132215 16:19862257-19862279 CTCTGCAGGCCGCGGGTGACAGG + Intronic
1136451895 16:30358315-30358337 CTCTGCGGACGGGGGGCGGCGGG + Exonic
1136544805 16:30948988-30949010 CTCTGCGGGCCCGGGACTGCGGG + Intergenic
1136620988 16:31428173-31428195 CGCGGCGGTCCTGGGGCGGCGGG + Intronic
1142239598 16:88939190-88939212 CTCAGGGGGGCTCGGGCGGCTGG + Intronic
1142892394 17:2952571-2952593 GTCTGCAGGCCCCGGGCTGCAGG - Intronic
1144107297 17:11997478-11997500 CTGCGCGCGCCTCAGGCGGCAGG + Intronic
1146052868 17:29566983-29567005 CCCGGCGGGCAGCGGGCGGCGGG + Exonic
1147161821 17:38572948-38572970 CTCTGCGGGGCTGCGCCGGCGGG - Intronic
1147331227 17:39700463-39700485 CCCTGGGGCCCTCGGGCGGGAGG + Intronic
1148048659 17:44758907-44758929 CCCTGCGGGGCTGGGGGGGCCGG + Intergenic
1148782327 17:50129295-50129317 TTCTCCGGGCGTCGGGCGGGAGG + Intronic
1151580146 17:74972846-74972868 CTCCGCGGGTCTTCGGCGGCGGG - Intronic
1152461853 17:80445799-80445821 TTCTGCAGGCCTCGGGCCCCAGG + Intergenic
1152468540 17:80478323-80478345 CTCTGCCGACCCCGGGCCGCAGG + Intergenic
1152748266 17:82051171-82051193 CTCCCCGGGCCTCGGGAGCCTGG + Intronic
1156250133 18:35344469-35344491 GTCTGCGGGCCTGAGGAGGCGGG + Intronic
1157667621 18:49500837-49500859 CTCTCCGGACCTTGGGCTGCTGG + Intergenic
1160810673 19:1011662-1011684 CACTGCGGGCACAGGGCGGCGGG + Exonic
1160842857 19:1154265-1154287 CACTGCAAGCATCGGGCGGCAGG + Exonic
1161809851 19:6465326-6465348 CTCTGCGGGACTGGGTCGGGGGG + Intronic
1162416988 19:10544150-10544172 GCCTGCGGGCCTCGGGCCGGCGG - Exonic
1162959614 19:14118081-14118103 GTCTGCGGGCCCGGGCCGGCGGG + Intronic
1163334334 19:16661142-16661164 GTCGCCGGGCCGCGGGCGGCGGG + Exonic
1163586922 19:18169273-18169295 CTCAGCGGGCGGCAGGCGGCGGG - Exonic
1164690643 19:30208515-30208537 CTCTGCTGGCCCCGGGGAGCTGG + Intergenic
1165065480 19:33225847-33225869 GACTGGGGGCCCCGGGCGGCGGG + Exonic
1165476177 19:36032362-36032384 CTCGGTGGCCCTCGGGGGGCGGG + Exonic
1165507877 19:36245819-36245841 AGCTGCGGGCCTCGGGCTACTGG + Intronic
1167088695 19:47328500-47328522 CTCTACAGGCCTCGGAAGGCAGG - Intergenic
1167435541 19:49476431-49476453 CTGCGGGGGCCTCTGGCGGCTGG + Exonic
1168722074 19:58559644-58559666 CTCAGCGTGCCTCGGAGGGCGGG + Intergenic
926190067 2:10721675-10721697 GGCTGCGGGCGACGGGCGGCGGG - Exonic
926197863 2:10774560-10774582 CTCAGGGGGCCTCGGGGTGCAGG - Intronic
929537448 2:42792571-42792593 AGCTGCGGGCCTCCGACGGCGGG - Exonic
932314116 2:70768273-70768295 CACCGCGGCCCTCGGGCGGCCGG - Intergenic
932496703 2:72149094-72149116 GGCTGCGGGCGGCGGGCGGCGGG - Intergenic
933278217 2:80304607-80304629 CTTTGCGGGCGGCGGGCGGCGGG + Exonic
933677130 2:85066889-85066911 CCCTGCTGGCCTCGGACTGCAGG - Intergenic
934893058 2:98087382-98087404 CTCGGCGGCTCTCGTGCGGCAGG - Intronic
938583905 2:132670632-132670654 CGCTGCGGGCCGCGGGAGCCTGG + Intronic
940987194 2:160062044-160062066 TCCTGCGGGGGTCGGGCGGCGGG - Intronic
944615209 2:201452146-201452168 CTCAGCGGGGCCCGGGCCGCGGG + Intronic
944801197 2:203239212-203239234 CGCTGCGGGCCGCAGGGGGCGGG + Intronic
948560581 2:238848764-238848786 CGCTGCGGGGGGCGGGCGGCAGG + Intronic
1169132393 20:3173075-3173097 CTCTGCGGGCCGTGGGCTGCTGG - Intronic
1169437990 20:5610745-5610767 CGCGGCGGGCCTGGGGCGTCGGG - Intronic
1171123831 20:22585397-22585419 CACTGCGGGTCCCTGGCGGCCGG - Intronic
1172013270 20:31858622-31858644 CTCTGCGGGTCTCAGGAGGCCGG + Intronic
1172464584 20:35146763-35146785 CTCTCTGGGCCTCGGCGGGCGGG - Intronic
1172644540 20:36461593-36461615 CTGGGCGGGCCCCGGGCGTCCGG - Intronic
1175429484 20:58891561-58891583 GACTGCGGGCCGCGGGCCGCGGG - Intronic
1175887976 20:62303058-62303080 GTCGCCGGGCCTGGGGCGGCCGG + Intronic
1175960892 20:62635940-62635962 GGCTGCGGGCTTCGGGCTGCGGG - Intergenic
1176005536 20:62860829-62860851 CTGTGCGGGCCCCGGGGAGCAGG - Intronic
1176118478 20:63443704-63443726 CTCTGCTGGCCTCAGGAGACGGG - Intronic
1176380645 21:6110837-6110859 GCGGGCGGGCCTCGGGCGGCGGG + Intergenic
1178680578 21:34669781-34669803 CTCTGCGGCCCCCGAGAGGCAGG + Exonic
1179025772 21:37677128-37677150 CTCTGCTGGCCTTGGACTGCAGG + Intronic
1179742827 21:43427403-43427425 GCGGGCGGGCCTCGGGCGGCGGG - Intergenic
1179901768 21:44397882-44397904 CTCTGCCGGGCACGGGCTGCAGG + Intronic
1180001144 21:44996069-44996091 CTCTGAGGTCCTCGGGAGGCTGG + Intergenic
1181534704 22:23535296-23535318 CTCTGTGGGCCTCAGGCTCCTGG + Intergenic
1182261159 22:29073574-29073596 CGCTGAGGGACTCGGGCAGCGGG - Intronic
1182353616 22:29712372-29712394 CTCTGCTGGCCTCGCCTGGCAGG - Intergenic
1183357239 22:37366394-37366416 CTCTGCCGGCCTTGGGCTGGGGG - Intergenic
1183546225 22:38455859-38455881 CTCGGCGCGCCGCGGGCGGCGGG - Intergenic
1183553452 22:38506820-38506842 CTCAGCGGGCCCAGGGCGGTGGG - Intronic
1183912601 22:41091277-41091299 CTCTTCGGCCCTTGGGTGGCGGG - Intergenic
1185055518 22:48576696-48576718 CACTGCGGGCCCGGAGCGGCCGG + Intronic
1185161860 22:49234759-49234781 CTCTGCTGGCCTCAGGCTGCTGG - Intergenic
949414213 3:3799232-3799254 CGCGGCGGGGCTCGGGTGGCCGG - Intronic
949894865 3:8761486-8761508 AACTGCTGGCCTGGGGCGGCAGG + Intronic
952125010 3:30290441-30290463 CTGTGCGGGTCTGGGGCAGCTGG + Intergenic
953697008 3:45167583-45167605 ATCTGTGGGCCTGGGCCGGCTGG - Intergenic
953878690 3:46680603-46680625 CTCTGCTGGCACGGGGCGGCAGG + Intronic
955246354 3:57228102-57228124 CCACGCGGGCCTTGGGCGGCGGG - Intronic
956605058 3:71065252-71065274 CTCTGCGGGGCCGGGGCTGCCGG + Intronic
959941503 3:112086290-112086312 CGTCGCGGACCTCGGGCGGCGGG - Intergenic
962804367 3:138916179-138916201 CTCTGAGGGCTGCGGGCTGCGGG - Intergenic
963188994 3:142448071-142448093 CCCGGCGGGCCTAGAGCGGCAGG + Intergenic
963189011 3:142448124-142448146 CCCTCCGGGCCTCGCGCGGCCGG + Intergenic
963358272 3:144237831-144237853 CTCTGCTGGACTCGGGTGGATGG + Intergenic
964614198 3:158644686-158644708 CTCTGCCAGCCTAGGGAGGCGGG - Exonic
968487179 4:868261-868283 GTCTGTGGGCCTGGGGAGGCTGG - Intronic
969597668 4:8158291-8158313 CTCTGCGTGCCTAGGTCTGCTGG + Intronic
969731360 4:8959642-8959664 CTCGGCGGGGCTGGAGCGGCTGG + Intergenic
970589769 4:17549301-17549323 CTCAGCGGGCGTGGGGCTGCCGG + Intergenic
971317672 4:25580904-25580926 CTCTGGGGGCCTGTGGCAGCGGG + Intergenic
971457927 4:26861282-26861304 CTCCGCGGGCGGCGGGCGACTGG + Exonic
972396686 4:38664180-38664202 CTCTGCGAGCCTCCCGGGGCTGG - Exonic
975666844 4:76741282-76741304 CTCTGCGGGCCCAGGGGTGCCGG - Exonic
982106408 4:152015443-152015465 CTCTGCTGGCCTCGGCAGGTAGG + Intergenic
984206579 4:176793117-176793139 CCCTGCGGGGAGCGGGCGGCCGG + Intergenic
984973439 4:185209969-185209991 CGCCGGGGGCCCCGGGCGGCCGG + Intronic
985674697 5:1224919-1224941 CACTGCTGCCCTCGGGCCGCTGG - Exonic
986705737 5:10453272-10453294 CTCTGTGGGCCGCGGGAGCCAGG - Intronic
993501583 5:88672908-88672930 CACTGCTGGCCTCGCGCCGCGGG + Intergenic
996900308 5:128537122-128537144 CTCTCCGGGGGTTGGGCGGCGGG - Intronic
997469315 5:134108100-134108122 CTCTGCAGACCTGGGGAGGCGGG + Intergenic
999731348 5:154478426-154478448 CTCTGCGGGCTTAGGGGGGCGGG + Intergenic
1000003451 5:157162193-157162215 CTCTGCTGGCCGTGGGCGGGTGG + Exonic
1001383434 5:171318586-171318608 CTCTGAGGGCCTCGGGGAGCTGG - Intergenic
1002508796 5:179699135-179699157 CTGTGAGGACCTCGGGGGGCTGG + Intronic
1004428062 6:15519467-15519489 CTCTCTGGGCCACGGGTGGCTGG - Intronic
1004694384 6:18020129-18020151 CTCTGCCGGCCCCGGGCAGAGGG + Intergenic
1007038830 6:38702856-38702878 GTCCGCCGGCCTCGGGCGGACGG - Intronic
1011633850 6:89352641-89352663 CTCAGCGCGGCTCGGGCGGACGG + Exonic
1017738225 6:157381956-157381978 CTCGGCGGGGCCCGCGCGGCCGG + Exonic
1017822893 6:158061624-158061646 CTCTGAGGGCCTGGGGCACCTGG + Intronic
1018091280 6:160348391-160348413 GGCTGCGGGCGGCGGGCGGCGGG + Exonic
1018996229 6:168712362-168712384 GTCTGGGGGCCTCGGGGTGCTGG + Intergenic
1019145097 6:169971155-169971177 CTCTGTGCTCCTGGGGCGGCCGG - Intergenic
1019456576 7:1130697-1130719 CTATGTGGGCCCCGGGCGGGTGG + Intronic
1020066287 7:5190598-5190620 CTCTGCGCGCCTTGGCCCGCGGG - Intronic
1023400826 7:39792335-39792357 CTGTGCAGGCTTCGGGAGGCAGG - Intergenic
1027137619 7:75636489-75636511 CTCTGGGGGCCTTTGGCTGCAGG - Intronic
1028928215 7:96383450-96383472 CTCTGAGGGCCTTGGGCCCCTGG + Intergenic
1029191813 7:98777390-98777412 CTCTGCTGGCCTTGGGGGACTGG - Intergenic
1031966464 7:128031314-128031336 CTCTGCGGGCCGCCGCCGGAGGG + Intronic
1032010469 7:128343742-128343764 CACTGCGGGCCGAGGGCGGGAGG + Exonic
1034263665 7:149771856-149771878 CCCTGCCGGGCTCGGGCGGGCGG - Intronic
1035388925 7:158492108-158492130 CTCTGTGTGCCTGGGGCGGGAGG - Intronic
1039921261 8:41896086-41896108 CTCTGCGGGCAGCTGGCGGGAGG + Intronic
1040032991 8:42842994-42843016 CCCTGCGCGCCTCGCGGGGCCGG - Intronic
1047864049 8:129002163-129002185 CTCTAAGGGCCTCATGCGGCTGG + Intergenic
1048288153 8:133158500-133158522 CTCTGAGGGCTTCGGTGGGCAGG - Intergenic
1049354409 8:142180382-142180404 CTCTGGGGGCCCTGGGCGGGCGG + Intergenic
1049710485 8:144060873-144060895 CTCTGCGGCCCTCGGGTCTCCGG + Intronic
1049761354 8:144333176-144333198 CTGTGCAGGCCTAGGGCGGCGGG - Exonic
1049761628 8:144334356-144334378 CTCTGCGAGGGTGGGGCGGCGGG - Intronic
1057148164 9:92772455-92772477 CTCTGCTGCACTCGGGAGGCTGG + Intergenic
1057653805 9:96937163-96937185 CTCTGCTGGCCTCGGGGGCCTGG - Exonic
1057658455 9:96977747-96977769 CTCTGTGAGGCTCAGGCGGCAGG + Intronic
1061237639 9:129351866-129351888 CTCTGGGGCCCTCGGGGCGCAGG + Intergenic
1061252806 9:129436566-129436588 CTCTGCGGGGAGCGGGGGGCGGG - Intergenic
1062277177 9:135736593-135736615 CGCGGCGGGCGGCGGGCGGCGGG - Intronic
1190267383 X:48835492-48835514 CTCTGGGGGCCGCGGGCCGGGGG - Exonic
1196723989 X:118879246-118879268 GCATGCGGGCCTCGGGTGGCAGG + Intergenic
1200210568 X:154345089-154345111 CTATGGGGGCCTCGGGGGCCTGG + Intergenic
1200220284 X:154387003-154387025 CTATGGGGGCCTCGGGGGCCTGG - Intergenic