ID: 1117920550

View in Genome Browser
Species Human (GRCh38)
Location 14:60722803-60722825
Sequence TCTGCGGGCCTCGGGCGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117920540_1117920550 -3 Left 1117920540 14:60722783-60722805 CCCGGCCGGCGCCGGCAGTCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1117920535_1117920550 15 Left 1117920535 14:60722765-60722787 CCTCGCGGAGGTGCAGACCCCGG 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1117920543_1117920550 -8 Left 1117920543 14:60722788-60722810 CCGGCGCCGGCAGTCTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1117920541_1117920550 -4 Left 1117920541 14:60722784-60722806 CCGGCCGGCGCCGGCAGTCTCTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1117920533_1117920550 25 Left 1117920533 14:60722755-60722777 CCCGGTGTGACCTCGCGGAGGTG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1117920534_1117920550 24 Left 1117920534 14:60722756-60722778 CCGGTGTGACCTCGCGGAGGTGC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1117920539_1117920550 -2 Left 1117920539 14:60722782-60722804 CCCCGGCCGGCGCCGGCAGTCTC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1117920530_1117920550 30 Left 1117920530 14:60722750-60722772 CCAGGCCCGGTGTGACCTCGCGG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117920550 Original CRISPR TCTGCGGGCCTCGGGCGGCA GGG Intronic
901007838 1:6180257-6180279 GCTGCGGGACTCGGGCTGCGGGG - Intergenic
902691013 1:18110092-18110114 TCTGCGGGCTGCGGGAGGCGGGG + Intronic
903173755 1:21568930-21568952 CCTGCGGGCCTGGGGCAGCTGGG + Intronic
905670704 1:39788585-39788607 TCGGCGGGCGGCGGGCGGCGGGG + Exonic
914961530 1:152213692-152213714 TCTTCGGGCCACGGCCGACAAGG - Exonic
914961777 1:152215102-152215124 TCTTCGGGCCACGGCCGACAAGG - Exonic
914962026 1:152216512-152216534 TCTTCGGGCCACGGCCGACAAGG - Exonic
914962275 1:152217922-152217944 TCTTCGGGCCACGGCCGACAAGG - Exonic
914962521 1:152219323-152219345 TCTTCGGGCCACGGCCGACAAGG - Exonic
916108624 1:161447869-161447891 TCTGGCGGCCCCGGGCGGCGAGG - Intergenic
916110212 1:161455250-161455272 TCTGGCGGCCCCGGGCGGCGAGG - Intergenic
916111797 1:161462660-161462682 TCTGGCGGCCCCGGGCGGCGAGG - Intergenic
916113384 1:161470041-161470063 TCTGGCGGCCCCGGGCGGCGAGG - Intergenic
918791995 1:188841237-188841259 TCTGGGAGGCTCGGGCCGCACGG + Intergenic
920002196 1:202807836-202807858 GCCGCGGGGCTCGGGCGGCCGGG - Intronic
1071519029 10:86317588-86317610 TGGGCAGGCCTCGGGCAGCAAGG + Intronic
1074413721 10:113249269-113249291 TCCGAGGGCCTCTGGCGGGAGGG + Intergenic
1076690838 10:132223223-132223245 TCTGCTGTCCTCTGGCGCCAGGG - Intronic
1078360738 11:10665719-10665741 GCTGCTGGCCTCAGTCGGCAAGG - Intronic
1083920840 11:65780849-65780871 GGTGCGGGCCGCGGGCGGGAGGG - Intergenic
1084647017 11:70464602-70464624 TCTGGTGGCCTCGGGGAGCAGGG + Intergenic
1089515697 11:119030295-119030317 CCGGCGGGCTTCGGGCTGCAGGG + Intronic
1091584053 12:1805886-1805908 TGGGCGGGCCGCAGGCGGCAGGG + Intronic
1102473285 12:113172422-113172444 TGTCCAGGCCTCGGGCGGCCAGG + Exonic
1104900697 12:132188259-132188281 TCTGGGGGCCTGCAGCGGCAGGG - Intergenic
1108541702 13:51452357-51452379 CCGGCGGCCCGCGGGCGGCAGGG - Intronic
1113799040 13:113077152-113077174 TCTGGGGGCCACCGGCTGCACGG - Exonic
1113955652 13:114098952-114098974 TCTGGGGGGCTCGGGTGGCCGGG - Intronic
1113955667 13:114098990-114099012 TCTGGGGGGCTCGGGTGGCCGGG - Intronic
1113955682 13:114099028-114099050 TCTGGGGGGCTCGGGTGGCCGGG - Intronic
1113955697 13:114099066-114099088 TCTGGGGGGCTCGGGTGGCCGGG - Intronic
1113955712 13:114099104-114099126 TCTGGGGGGCTCGGGTGGCCGGG - Intronic
1113955727 13:114099142-114099164 TCTGGGGGGCTCGGGTGGCCGGG - Intronic
1113955742 13:114099180-114099202 TCTGGGGGGCTCGGGTGGCCGGG - Intronic
1115961259 14:38837678-38837700 TCTGCGGGCCTCAGAGTGCAGGG + Intergenic
1117920550 14:60722803-60722825 TCTGCGGGCCTCGGGCGGCAGGG + Intronic
1119106811 14:71932560-71932582 TCTGCCCGCCCCGGTCGGCAAGG - Exonic
1121544028 14:94750655-94750677 TCTGAGGGGCTGGGGCAGCAGGG - Intergenic
1122942082 14:104985966-104985988 TCTGCGGGCCGCGTGCGAGAGGG + Exonic
1123012545 14:105356360-105356382 TCTGAGGCCCTGCGGCGGCACGG - Intronic
1127165817 15:56243942-56243964 TGTGCGGGCCGCGGGCGCGACGG + Intergenic
1127977990 15:64013093-64013115 TCTGGGGGTCTGGGGTGGCAGGG - Intronic
1129319688 15:74767703-74767725 TCTGCAGCCCTGGGGCAGCAGGG - Intergenic
1129708683 15:77809203-77809225 CCTGCAGGCCTCGGGCTGGAGGG - Intronic
1129854263 15:78812322-78812344 TGTGCGGGCCTCAGAGGGCAGGG - Intronic
1129917168 15:79283781-79283803 ACTGTGCGCCTCGGGCGGCGGGG - Intergenic
1132551387 16:555219-555241 CGGGCGGGCCTCGGGCGGCGGGG + Intergenic
1132567103 16:628597-628619 CCTGGGGGCCTCGGGAGGCTAGG + Exonic
1132883209 16:2171382-2171404 TGTGGGGGCCTCTGGCAGCAGGG - Intronic
1133318602 16:4899194-4899216 TCTGGGGGCCTGGGGCATCAGGG - Intronic
1141147216 16:81539672-81539694 ACTGCGGGCCTCAGGTGGTAGGG - Intronic
1142139588 16:88466922-88466944 TCTGGGGCCCTTGTGCGGCAGGG + Intronic
1143782929 17:9239004-9239026 TCTGGGGACCTTGGGCGGCATGG + Intronic
1144143143 17:12369650-12369672 TCTTCGGGCCTGGGGAGCCAGGG - Intergenic
1145246928 17:21275631-21275653 TCCGCGGCCCTCGGGAGGCCCGG + Intergenic
1145351780 17:22090131-22090153 CCTGTGTGCCTCGGGGGGCAAGG - Intergenic
1146926005 17:36745916-36745938 TCTGCAGACCTCGGGTGGAAGGG - Intergenic
1147015542 17:37489318-37489340 CCTCCGGGTCTCGGGCGCCACGG + Intergenic
1147331229 17:39700464-39700486 CCTGGGGCCCTCGGGCGGGAGGG + Intronic
1148782328 17:50129296-50129318 TCTCCGGGCGTCGGGCGGGAGGG + Intronic
1151457793 17:74236839-74236861 TCTTCAGGCCTGGGGCAGCATGG + Intronic
1152685469 17:81691643-81691665 TCTGCAGGCCTCAGGCACCATGG - Intronic
1153911500 18:9709198-9709220 TCTGCAGTCCCCGGGCCGCACGG - Intronic
1156250134 18:35344470-35344492 TCTGCGGGCCTGAGGAGGCGGGG + Intronic
1157278984 18:46333808-46333830 TCTCCGGCCCGCGGGCGGCCAGG + Intronic
1158259395 18:55590259-55590281 TCAGCGAGCCTTGGGCGGCATGG + Intronic
1160006288 18:75071486-75071508 GCTGTGGGCCCCGGGCTGCAGGG + Intergenic
1162959615 19:14118082-14118104 TCTGCGGGCCCGGGCCGGCGGGG + Intronic
1165065481 19:33225848-33225870 ACTGGGGGCCCCGGGCGGCGGGG + Exonic
1166358666 19:42242486-42242508 GCTGCGGGGCTCGGGCTGCCCGG + Exonic
1166765779 19:45251564-45251586 TCTCCGGGTCCCGGGGGGCAGGG - Exonic
1167108777 19:47447007-47447029 TCTGGGGGCCTGGGAAGGCAGGG - Intronic
1167110457 19:47457594-47457616 CCTGCGGGCGGCGGGCGTCAGGG + Exonic
1167709938 19:51104383-51104405 CGTGGGCGCCTCGGGCGGCAAGG - Exonic
1167780996 19:51598708-51598730 CCTGGGCACCTCGGGCGGCAAGG + Intergenic
926197862 2:10774559-10774581 TCAGGGGGCCTCGGGGTGCAGGG - Intronic
927019809 2:19004869-19004891 TCTGCGGGTCCTGGGTGGCATGG + Intergenic
933727193 2:85433657-85433679 GCTGAGGGCCTCGGGCAGGAGGG - Intronic
934769464 2:96898736-96898758 TCTGAGGGCCTTGGGCTGCTAGG + Intronic
938480979 2:131661262-131661284 TTTGCCAGCCTCGGGCTGCATGG - Intergenic
940987192 2:160062043-160062065 CCTGCGGGGGTCGGGCGGCGGGG - Intronic
947718266 2:232352497-232352519 TCTGCGACCCTCGGGCCGCCTGG + Intergenic
947793110 2:232878921-232878943 TCTGCCAGCCTCTGGCTGCACGG - Exonic
948560582 2:238848765-238848787 GCTGCGGGGGGCGGGCGGCAGGG + Intronic
1173188703 20:40860300-40860322 TCTGCGGGGTGCGGGGGGCATGG + Intergenic
1175429483 20:58891560-58891582 ACTGCGGGCCGCGGGCCGCGGGG - Intronic
1175887977 20:62303059-62303081 TCGCCGGGCCTGGGGCGGCCGGG + Intronic
1179512038 21:41879449-41879471 ACTGCGGGGCGCGGGCGGCGTGG + Exonic
1179971063 21:44836797-44836819 TCTGAGGTCCTGGAGCGGCAGGG - Intergenic
1180001145 21:44996070-44996092 TCTGAGGTCCTCGGGAGGCTGGG + Intergenic
1180966050 22:19788480-19788502 CCTGCAGGCCTCGGACGGCCAGG + Exonic
1181984450 22:26789783-26789805 ACTGTGGGCCTCGGGTGACATGG + Intergenic
1182872592 22:33661831-33661853 TCTGCTGTCCTCGGGAGGGAGGG + Intronic
1185161859 22:49234758-49234780 TCTGCTGGCCTCAGGCTGCTGGG - Intergenic
949894866 3:8761487-8761509 ACTGCTGGCCTGGGGCGGCAGGG + Intronic
953878691 3:46680604-46680626 TCTGCTGGCACGGGGCGGCAGGG + Intronic
963189013 3:142448125-142448147 CCTCCGGGCCTCGCGCGGCCGGG + Intergenic
968258151 3:197297891-197297913 TCCGCGGGCCCCGGGCGGGGCGG - Intronic
977922918 4:102665571-102665593 TATGCAGGCCTCGTGTGGCACGG - Intronic
985064016 4:186104591-186104613 TCTGCGAGGCTCGGGGCGCAGGG + Intronic
986705736 5:10453271-10453293 TCTGTGGGCCGCGGGAGCCAGGG - Intronic
997453872 5:134004118-134004140 TCTGCGGGCGTGGGCCGGCCAGG + Intronic
999289051 5:150411656-150411678 TGTGCTGGCCTCTGGCTGCAAGG + Intronic
1001383433 5:171318585-171318607 TCTGAGGGCCTCGGGGAGCTGGG - Intergenic
1002898044 6:1390431-1390453 CCTAAGGGCCTCGGGCGGCCCGG + Exonic
1004411547 6:15385835-15385857 TCTGGGGGCCTAGGGTGTCACGG - Intronic
1006170189 6:32087874-32087896 TCTGCTGGCCTCGAGGGCCAAGG + Intronic
1006431894 6:34002313-34002335 TCTGAGGCCCTCGGGGGGAAGGG + Intergenic
1007038829 6:38702855-38702877 TCCGCCGGCCTCGGGCGGACGGG - Intronic
1007421900 6:41724623-41724645 ATTGCAGGTCTCGGGCGGCAAGG - Intronic
1011555276 6:88566674-88566696 GCTGAGGGCCACGGGAGGCATGG - Intergenic
1018951128 6:168379492-168379514 TGTGTGGGACTCGGGCTGCATGG - Intergenic
1018996230 6:168712363-168712385 TCTGGGGGCCTCGGGGTGCTGGG + Intergenic
1020213238 7:6170713-6170735 TCAGCGGGACCAGGGCGGCAAGG + Intronic
1021992509 7:26152139-26152161 GGCGCGGGCCCCGGGCGGCAGGG + Intergenic
1024052072 7:45630888-45630910 TCTGGGGGTCTCGGGAGGCATGG + Intronic
1024969262 7:55053702-55053724 GCTGCGGGCCTGGCCCGGCAAGG - Intronic
1032525797 7:132577432-132577454 GCGGCGGGCGGCGGGCGGCAGGG - Intronic
1034513270 7:151553414-151553436 TCTGCGGGGCTCAGGCGCGAAGG - Intergenic
1035125866 7:156607532-156607554 TCTGGGGGCCTCGGAGGTCACGG - Intergenic
1035388924 7:158492107-158492129 TCTGTGTGCCTGGGGCGGGAGGG - Intronic
1040415248 8:47189284-47189306 ACTGCAGGCCTCAGGCGGCTCGG - Intergenic
1041689847 8:60678512-60678534 GCCGCGGGCCGCGGGCCGCAAGG - Intergenic
1047403154 8:124562785-124562807 GTTGGGGGCCTCTGGCGGCATGG + Exonic
1049435547 8:142584618-142584640 TCTGTGGACTTCAGGCGGCATGG - Intergenic
1049688658 8:143949369-143949391 TGTGTGAGCCTCGGGCTGCAGGG + Intronic
1049761353 8:144333175-144333197 TGTGCAGGCCTAGGGCGGCGGGG - Exonic
1057336208 9:94157086-94157108 CCTGCAGGCCTCGGGCAGCCTGG - Intergenic
1057653804 9:96937162-96937184 TCTGCTGGCCTCGGGGGCCTGGG - Exonic
1061943091 9:133893449-133893471 TCTGGGGTCCTCAGGTGGCAAGG + Intronic
1192172750 X:68867197-68867219 CCTGTGGGCCTCGAGCAGCATGG + Intergenic
1196723990 X:118879247-118879269 CATGCGGGCCTCGGGTGGCAGGG + Intergenic
1200686712 Y:6265183-6265205 TCATCGGGCCTCGGGGGGTATGG - Intergenic
1200989590 Y:9336099-9336121 TCATCGGGCCTCGGGGGGTATGG - Intergenic
1200992259 Y:9356432-9356454 TCATCGGGCCTCGGGGGGTATGG - Intergenic
1200994910 Y:9376710-9376732 TCATCGGGCCTCGGGGGGTATGG - Intronic
1200997575 Y:9397056-9397078 TCATCGGGCCTCGGGGGGTATGG - Intergenic
1201000087 Y:9465592-9465614 TCATCGGGCCTCGGGGGGTATGG - Intergenic
1201002746 Y:9485902-9485924 TCATCGGGCCTCGGGGGGTATGG - Intronic
1201005403 Y:9506186-9506208 TCATCGGGCCTCGGGGGGTATGG - Intergenic