ID: 1117920552

View in Genome Browser
Species Human (GRCh38)
Location 14:60722813-60722835
Sequence TCGGGCGGCAGGGAGAGCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117920541_1117920552 6 Left 1117920541 14:60722784-60722806 CCGGCCGGCGCCGGCAGTCTCTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1117920552 14:60722813-60722835 TCGGGCGGCAGGGAGAGCTACGG 0: 1
1: 0
2: 0
3: 12
4: 113
1117920535_1117920552 25 Left 1117920535 14:60722765-60722787 CCTCGCGGAGGTGCAGACCCCGG 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1117920552 14:60722813-60722835 TCGGGCGGCAGGGAGAGCTACGG 0: 1
1: 0
2: 0
3: 12
4: 113
1117920545_1117920552 -4 Left 1117920545 14:60722794-60722816 CCGGCAGTCTCTGCGGGCCTCGG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1117920552 14:60722813-60722835 TCGGGCGGCAGGGAGAGCTACGG 0: 1
1: 0
2: 0
3: 12
4: 113
1117920539_1117920552 8 Left 1117920539 14:60722782-60722804 CCCCGGCCGGCGCCGGCAGTCTC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1117920552 14:60722813-60722835 TCGGGCGGCAGGGAGAGCTACGG 0: 1
1: 0
2: 0
3: 12
4: 113
1117920543_1117920552 2 Left 1117920543 14:60722788-60722810 CCGGCGCCGGCAGTCTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1117920552 14:60722813-60722835 TCGGGCGGCAGGGAGAGCTACGG 0: 1
1: 0
2: 0
3: 12
4: 113
1117920540_1117920552 7 Left 1117920540 14:60722783-60722805 CCCGGCCGGCGCCGGCAGTCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1117920552 14:60722813-60722835 TCGGGCGGCAGGGAGAGCTACGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117920552 Original CRISPR TCGGGCGGCAGGGAGAGCTA CGG Intronic
900515472 1:3079942-3079964 TCTGGCGCCACGGAGGGCTAAGG - Intronic
902858019 1:19223340-19223362 TCAGGAGGCAGGGAGACCTCTGG + Intronic
903128215 1:21262024-21262046 TCGGGGGGCAGGGAGCTCTCGGG - Intronic
905421343 1:37847540-37847562 TGGGGCACCAGGCAGAGCTAAGG - Intronic
906815865 1:48877807-48877829 TATGGCAGCAGGGAGAGCAATGG + Intronic
911042157 1:93599578-93599600 TCTGGCTGCAGTGAGAGCAATGG + Intronic
918125630 1:181580857-181580879 TCCGGGGACAGGGAGGGCTATGG + Intronic
922236085 1:223723804-223723826 AGAGGGGGCAGGGAGAGCTAAGG - Intronic
923795000 1:237145065-237145087 TCGGGGGGTTGGGGGAGCTAGGG + Intronic
1063015843 10:2076284-2076306 TCGGGAAGCAGGAACAGCTAAGG + Intergenic
1063535394 10:6877808-6877830 TGAGGAGGCAGGCAGAGCTACGG - Intergenic
1063953330 10:11244088-11244110 TCTGGCAGCAGGGAGGGCCAGGG + Intronic
1064162692 10:12959575-12959597 TCAGGGGTCAGGGTGAGCTAAGG + Intronic
1075227394 10:120642037-120642059 ATGGGGGGCAGGGAGAGCTATGG + Intergenic
1076883887 10:133252509-133252531 ACGGGGTGCAGGGAGAGCTGGGG - Intergenic
1077211857 11:1374907-1374929 ACGGGCAGCAGGCAGAGCTGTGG + Intergenic
1078164570 11:8871084-8871106 CCGGGCTGCAGGGAGAGAGAGGG + Intronic
1080438383 11:32267874-32267896 TGGGGTGGAAGGGAGTGCTAGGG - Intergenic
1083635571 11:64119012-64119034 CCAGGTGGCAGGGAAAGCTACGG - Exonic
1083641859 11:64149974-64149996 GAGGGCAGCAGGGAGAGCTAGGG - Intronic
1083740919 11:64711479-64711501 TCGGGGGGCAGGGGGCGCTGAGG - Intronic
1084683083 11:70678479-70678501 TCGAGAGGCAGGGAGAGGCAGGG - Intronic
1085033417 11:73286244-73286266 TCAGGCCCCAGGAAGAGCTAGGG + Intronic
1085670126 11:78455672-78455694 TGGGGTGGCAGGAAGAGCTATGG - Intronic
1091647582 12:2285427-2285449 TAGGGCTGCAGGGAGAGCCCAGG + Intronic
1097717264 12:62980174-62980196 TAGGGCGGCAGGCTGAGCAAAGG - Intergenic
1098217164 12:68233145-68233167 TTGGGGGGCAGGGAGGGTTAGGG - Intergenic
1098440085 12:70508550-70508572 TTGGCAGGCAGGGAGTGCTAGGG - Intergenic
1101967278 12:109290308-109290330 TCGGGCGGGAGGGGGAGCTTAGG + Intronic
1104706775 12:130953494-130953516 TCGGACGTCAGTGAAAGCTACGG - Intergenic
1105701879 13:22940346-22940368 TGGGGCAGCAGGGAGGGCCAAGG + Intergenic
1106054300 13:26223535-26223557 TCGGGCTGGAGGGTGAGGTAAGG - Intergenic
1106355157 13:28975289-28975311 TCGGGAAGCAGGGAGAACTAAGG - Intronic
1107293798 13:38888371-38888393 TCAGGAGGCAGAGGGAGCTAGGG + Intergenic
1108408207 13:50125032-50125054 CCGGGCGGTAGGGAGAGCGGAGG - Intronic
1113618506 13:111697410-111697432 TCTGGAGGCAGGGAGAGGAAGGG - Intergenic
1113624035 13:111782671-111782693 TCTGGAGGCAGGGAGAGGAAGGG - Intergenic
1113644146 13:111980455-111980477 TGGGGAGGCAGGGAGGGCTCTGG - Intergenic
1117920552 14:60722813-60722835 TCGGGCGGCAGGGAGAGCTACGG + Intronic
1118610036 14:67532994-67533016 TGGGGCGGCAGGGAGGGCGGCGG - Intronic
1123131298 14:105987730-105987752 CTGGGTGGCAGGGAGCGCTAGGG - Intergenic
1123930693 15:25170382-25170404 TTGGGTGGCAGGGAGGGCCAAGG + Intergenic
1123943663 15:25228632-25228654 TTTGGCGGCAGGGAGGGCCAAGG + Intergenic
1125461099 15:39907596-39907618 TCAGCAGGCAGGGAGGGCTAAGG - Intronic
1125714716 15:41812950-41812972 CAGGGCTGCTGGGAGAGCTACGG + Exonic
1132696695 16:1205096-1205118 TCGGGCTGCAGGCAGAGGTGGGG - Exonic
1136139840 16:28281525-28281547 TCGGGTGGGAGGAAGAGGTAAGG + Intergenic
1138616742 16:58173984-58174006 TGGGGCAGCAGGGATAGCTGAGG - Intronic
1139515717 16:67451277-67451299 TCGGGCGGCCAAGAGAGCTGCGG + Intronic
1139558470 16:67727478-67727500 ACGGGTAGCAGGGTGAGCTATGG - Intronic
1139669877 16:68485399-68485421 TCTGGTGTCAGGGAGGGCTATGG - Intergenic
1140239220 16:73185938-73185960 TCTGACGGGAGGCAGAGCTAAGG - Intergenic
1148051623 17:44772504-44772526 TCGGGCTGCAGAGAGACCTCAGG + Intronic
1148582450 17:48753039-48753061 GCGGGCGGCAGGGAGAGGGAAGG + Intergenic
1148714426 17:49705722-49705744 ATGGGCAGCAGGGAGAGCTGGGG + Intronic
1148771777 17:50071539-50071561 TCTGGGGCCAGGGAGAGCGATGG + Intronic
1150640412 17:66945988-66946010 GCGGTGGGCAGGGAGAGTTAGGG - Intergenic
1151660345 17:75515395-75515417 GCGGGCGGCCGGGAGAGGTGAGG - Exonic
1152798002 17:82317357-82317379 TCATGGGGCAGGGAGAGCTCTGG + Intronic
1162595701 19:11627376-11627398 TCTGGCTGCAGACAGAGCTATGG + Intergenic
1163312384 19:16522129-16522151 ATGGGCAGCAGGGAGAGCTGCGG - Intronic
1164522979 19:28992847-28992869 TCAGGAGGCAGGGAGAGCAAGGG - Intergenic
1164912941 19:32027044-32027066 TGGGGTGGCAGGTAAAGCTATGG - Intergenic
1166876812 19:45902506-45902528 GGGGACGGCAGGGAGAGCGAAGG + Intronic
1167198029 19:48044120-48044142 TGGGGAGGCAGGGACAGCTCTGG - Intergenic
1168324572 19:55531347-55531369 TGGGGCAGCAGGGACAGGTATGG + Intronic
925649433 2:6073683-6073705 TTGAGCTGCAGGCAGAGCTAGGG + Intergenic
927212223 2:20645863-20645885 TGGGGCTGCAGGGACAGCAAGGG + Intronic
932403226 2:71496384-71496406 TCAGGAGGCAGAGAGAGCGAGGG + Intronic
933773581 2:85758768-85758790 TGAGGCGGCAGGGAGGGCTCTGG - Intronic
935706133 2:105859370-105859392 TAGGGTGGCAGGGTGAGCCACGG - Intronic
943632773 2:190272757-190272779 TGGGGGGGCAGGGAGACCGAAGG + Intronic
948771151 2:240251831-240251853 GCGGGAGGGAGGGAGAGCTGGGG - Intergenic
948845620 2:240681575-240681597 TGGGGCTGCAGGGAGAGCCAGGG - Intronic
948848235 2:240693155-240693177 TGGGGCTGCAGGGAGAGCCAGGG + Intronic
948864377 2:240767982-240768004 TCAGGGGGCAGGGACAGCTGGGG - Intronic
1173788063 20:45809374-45809396 GGGGGCGGAAGGGAGACCTAGGG - Intronic
1175624494 20:60479066-60479088 TCGTGCAGCAGGGAGAGCTCAGG - Intergenic
1175935239 20:62510991-62511013 TGGGGCAGCAGGGGGAGCTAAGG - Intergenic
1178332055 21:31706490-31706512 TAGGGCAGCAGGAAGAGCTTTGG + Intronic
1178914414 21:36698820-36698842 ATGGGCGGCAGGGAGGGCGAGGG - Intergenic
1179503124 21:41822239-41822261 GCGGGCGGCGTGGAGAGCAAGGG - Intronic
1179573493 21:42292102-42292124 TCGGGGGGCAGGGTGGGCGATGG - Intronic
1179793433 21:43768649-43768671 TCTGGGGGCAGGGAGCGCTGTGG - Intergenic
1180159126 21:45991248-45991270 TCGGGCTGCAGGGAAGGCTCTGG - Intronic
1181177815 22:21047706-21047728 TGGGGGGTCAGGGAGAGCTGGGG + Intronic
1182423776 22:30261238-30261260 TGGGGAGGCGGGAAGAGCTAGGG - Intergenic
1182735318 22:32529012-32529034 TGGGGAGGAAGGGAGAGCTGAGG + Intronic
1183608454 22:38881395-38881417 TTGGGCAGCAGGAAGAGATAAGG - Intergenic
1184213946 22:43053910-43053932 TGGGGAGGGAGGGAGAGCAAAGG + Intronic
1184843744 22:47068058-47068080 GCGCTCGGCAGGGAGAGCTGGGG + Intronic
949782767 3:7708744-7708766 CCCGGCTGCTGGGAGAGCTAGGG - Intronic
952946256 3:38479510-38479532 CCAGGAGGCAGGGAGGGCTAGGG - Intronic
955799459 3:62670932-62670954 TGGGGTGGAAGAGAGAGCTAAGG - Intronic
958056479 3:88418919-88418941 TCTGACGGCAGGCAGAGCTCAGG - Intergenic
960702315 3:120450838-120450860 TCGGGCGGCCGGGGGTGCTTGGG - Intronic
971150097 4:24022376-24022398 TGGGGAGGCAGTGAGCGCTATGG - Intergenic
977257708 4:94758467-94758489 TGGGGCGGGAGGGCGAGCTGAGG + Intronic
986247918 5:6028069-6028091 TAAGGCTGCAGGGAGAGCAAAGG - Intergenic
987103127 5:14610258-14610280 TCGGTCAGCAGGGAGATCTCCGG - Exonic
995789531 5:115870420-115870442 TCAGGAGACAGGGAGAGGTAGGG - Intronic
996531861 5:124535116-124535138 TGGAGAGGCAGGGTGAGCTAAGG - Intergenic
997729567 5:136157708-136157730 TCAGGCGGTAGTGAGAGCAATGG + Intronic
1002195010 5:177496850-177496872 TCGGGCGGCCGGGTGAGTCAGGG + Intronic
1006601797 6:35231265-35231287 TCTGGGTGCAGGCAGAGCTATGG - Intronic
1010761825 6:79732811-79732833 TCAGGAGGCAGAGAGAGCTATGG - Intergenic
1019319894 7:410865-410887 TGGGGCTGCAGGGAGGGCCATGG - Intergenic
1019708456 7:2507514-2507536 GCGGCCGGCAGGGAGAGAGAGGG - Intergenic
1020130078 7:5554908-5554930 TCGGGCAGCAGAGAGATCTGAGG - Intronic
1024526340 7:50353168-50353190 ACAGGAGGCAGGGAGAGCAATGG + Intronic
1029448487 7:100627715-100627737 TGGGGGGGTAGGGAGAGCTGGGG - Intronic
1032363357 7:131276273-131276295 TGGGGAGAGAGGGAGAGCTAGGG + Intronic
1036780451 8:11643346-11643368 TCTGGCGGCTGGGAGGGCGAGGG - Intergenic
1037014144 8:13881659-13881681 TCGGGAGGCAGAGAGAGGTGGGG + Intergenic
1037892411 8:22630245-22630267 TCAGGAGGCAGGTAGAGCCAAGG + Intronic
1042458443 8:69033352-69033374 CTGGGAGACAGGGAGAGCTAAGG + Intergenic
1045277912 8:100722899-100722921 TTGGGGGGCAGGGAGAGAGAGGG + Intergenic
1046654225 8:116874790-116874812 TTGGGCGGCAGGAAGAGCCGCGG - Exonic
1049155997 8:141067226-141067248 TCGGGAGGGAGGCAGAGCTGTGG + Intergenic
1049418746 8:142507510-142507532 TCTGGGGGCAGGGAGAGAGACGG - Intronic
1056507516 9:87271199-87271221 TCTGGAGGGAGGGAGAGGTAAGG - Intergenic
1057817639 9:98307328-98307350 GCGGGCTGCAGGGACAGCTCAGG + Intronic
1059191887 9:112334007-112334029 TCTGCCGGCAGGAAAAGCTATGG + Intergenic
1190246861 X:48696623-48696645 CCGGGCGGCAGGGAGGGGTTCGG + Intronic
1197550078 X:127881011-127881033 TTGGGCTGCAGGCAGAGCTTAGG - Intergenic
1202027304 Y:20538283-20538305 TCAGGCTGCAGGGACAGATAAGG + Intergenic