ID: 1117920553

View in Genome Browser
Species Human (GRCh38)
Location 14:60722819-60722841
Sequence GGCAGGGAGAGCTACGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 0, 3: 63, 4: 288}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117920545_1117920553 2 Left 1117920545 14:60722794-60722816 CCGGCAGTCTCTGCGGGCCTCGG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1117920553 14:60722819-60722841 GGCAGGGAGAGCTACGGTGCCGG 0: 1
1: 0
2: 0
3: 63
4: 288
1117920539_1117920553 14 Left 1117920539 14:60722782-60722804 CCCCGGCCGGCGCCGGCAGTCTC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1117920553 14:60722819-60722841 GGCAGGGAGAGCTACGGTGCCGG 0: 1
1: 0
2: 0
3: 63
4: 288
1117920541_1117920553 12 Left 1117920541 14:60722784-60722806 CCGGCCGGCGCCGGCAGTCTCTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1117920553 14:60722819-60722841 GGCAGGGAGAGCTACGGTGCCGG 0: 1
1: 0
2: 0
3: 63
4: 288
1117920543_1117920553 8 Left 1117920543 14:60722788-60722810 CCGGCGCCGGCAGTCTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1117920553 14:60722819-60722841 GGCAGGGAGAGCTACGGTGCCGG 0: 1
1: 0
2: 0
3: 63
4: 288
1117920540_1117920553 13 Left 1117920540 14:60722783-60722805 CCCGGCCGGCGCCGGCAGTCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1117920553 14:60722819-60722841 GGCAGGGAGAGCTACGGTGCCGG 0: 1
1: 0
2: 0
3: 63
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117920553 Original CRISPR GGCAGGGAGAGCTACGGTGC CGG Intronic
900951420 1:5860079-5860101 GCCAGGGAGGACTCCGGTGCTGG - Intergenic
901011894 1:6206861-6206883 GGCGGGGAGAGCTAAGGACCGGG - Intronic
901025972 1:6278942-6278964 GGCAGGAAGAGGTAGGGGGCGGG + Intronic
901186360 1:7375886-7375908 GGCAGGGAGAGGTACCCTGTAGG + Intronic
901486315 1:9565095-9565117 GGGAGGGAGGGCTAGGGAGCTGG + Intronic
903379566 1:22887278-22887300 GGAAGGGACAGCTAGGCTGCAGG + Intronic
903603053 1:24556117-24556139 GGCTGGGAGCGCGGCGGTGCCGG + Exonic
904482058 1:30800336-30800358 AGCAGGAAGAGCCGCGGTGCAGG + Intergenic
904804465 1:33120919-33120941 TGCAGGGAGAGCAAGGGTGCAGG - Intergenic
905884372 1:41484002-41484024 GGCAGGGGGAGCTCTGGGGCAGG - Intronic
906211238 1:44013327-44013349 GGCAGGGGGAGGTACGGGGAAGG + Intronic
906311950 1:44760509-44760531 GGCCGGGAGAGCTACTGGGAAGG + Intronic
908130806 1:61073610-61073632 GGCAGGCAGAGCCAAGGTGGTGG - Intronic
912277313 1:108273076-108273098 GGCGGCGAGTGCTGCGGTGCTGG + Intergenic
912290915 1:108421280-108421302 GGCGGCGAGTGCTGCGGTGCTGG - Intronic
912508651 1:110173830-110173852 GGCAAGGAGGGATAGGGTGCGGG - Intronic
917095728 1:171397165-171397187 GGGAGGGAGAGTTTCTGTGCCGG - Intergenic
917114345 1:171587018-171587040 GGCAAGGAAAGCTGCGATGCTGG - Exonic
920260510 1:204685159-204685181 GTCAGGCGGAGCTGCGGTGCCGG + Intronic
920726328 1:208438641-208438663 GGCAAGGAGAGGTACAGTCCAGG + Intergenic
923525291 1:234767937-234767959 GGCAGGGACAGATACTTTGCAGG + Intergenic
924456131 1:244220054-244220076 CGCAGGGAGAGGGACCGTGCTGG + Intergenic
1062930981 10:1352419-1352441 GTCAGGGAGAGCTAGGGTGGCGG - Intronic
1062973605 10:1666525-1666547 AGCAGGGAGAGCTAATGGGCTGG - Intronic
1063437652 10:6047421-6047443 GGCAGGAAGAGCTTTGGAGCAGG - Intronic
1063958678 10:11288156-11288178 GCCAGGGAGAACTACGGGGTGGG + Intronic
1064162693 10:12959581-12959603 GTCAGGGTGAGCTAAGGAGCAGG + Intronic
1065437852 10:25720140-25720162 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
1067065387 10:43101436-43101458 GCCAGGGACAGCCAGGGTGCAGG + Intronic
1067552752 10:47246883-47246905 GGCAGGGAGTGGGACGGGGCAGG + Intergenic
1067709691 10:48638019-48638041 AGCAGGGAGAGCTACTAGGCAGG - Intronic
1069589635 10:69633892-69633914 GGTCGGGAGAGCTGGGGTGCAGG + Intergenic
1071508224 10:86245719-86245741 GGCAGGGACAGCTTTGGGGCAGG - Intronic
1074019255 10:109566049-109566071 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1075064395 10:119279690-119279712 GGCAAGAAGAGCCACGCTGCAGG + Intronic
1075239050 10:120760793-120760815 GGCAGGGAGTGCAAAGGTGGAGG - Intergenic
1076700962 10:132272457-132272479 GGCAGTGTGAGCTAGGGAGCTGG - Intronic
1076883880 10:133252486-133252508 TGCAGGGAGGGATAGGGTGCAGG - Intergenic
1076883886 10:133252503-133252525 TGCAGGGAGAGCTGGGGTGCAGG - Intergenic
1077131836 11:976889-976911 GGCAGGGAGACCTTTGGAGCAGG + Intronic
1078599203 11:12715609-12715631 GGCATGGAGACCTACCTTGCAGG + Intronic
1078789245 11:14526311-14526333 GTCAGGGAGAGCTAGTGTGGGGG - Intronic
1079376765 11:19899987-19900009 GCCAGGGAGAGCTTAGGTGTCGG + Intronic
1081159952 11:39738254-39738276 GTCAGGGAGAGCTAGTGTGGGGG - Intergenic
1082773642 11:57228923-57228945 GGCTGGGAGTACTAGGGTGCTGG + Intergenic
1084613061 11:70216355-70216377 GTCAGGGAGAGCTCAGGTGGGGG + Intergenic
1085025000 11:73231162-73231184 GGCAGGGGGAACAAGGGTGCAGG + Intronic
1086134063 11:83429398-83429420 GTCAGGGAGAGCTTCAGTGTGGG + Intergenic
1086134611 11:83433630-83433652 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1086136047 11:83444926-83444948 GTCAGGGAGAGCTAGGGTTGGGG + Intergenic
1086550434 11:88046874-88046896 GTCAGGGAGAGCTAGGGTGAGGG - Intergenic
1087099861 11:94353319-94353341 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1087172800 11:95067528-95067550 GCCAGGGAGAGCCACGCGGCAGG + Exonic
1087732160 11:101791212-101791234 GGCACTGAGTGCTATGGTGCTGG - Intronic
1088555179 11:111053878-111053900 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1089604627 11:119634778-119634800 GGCAGGGAGAGCCTCAGAGCAGG - Intronic
1089953560 11:122550806-122550828 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1090107378 11:123867603-123867625 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1090546275 11:127771103-127771125 GTCAGGGAGAGCTGGGGTGGGGG + Intergenic
1090633992 11:128677191-128677213 TGCAGGGAGAGCCACAGGGCCGG - Intergenic
1091183905 11:133630482-133630504 GTCAGGGAGATCTAAGGTGGGGG - Intergenic
1091217132 11:133909001-133909023 GGCAGGGAGGGCCACTGTGTGGG - Exonic
1091254413 11:134171617-134171639 GCCAGGGAGAACTAGGGTGTAGG - Intronic
1091750701 12:3019765-3019787 GGCAGGGAAAGCCAAGGGGCCGG - Intronic
1092228862 12:6766188-6766210 GGGAGGGAGAGCTAGGGAGTCGG - Intronic
1092459427 12:8673253-8673275 GACAGGTAGAGGTACAGTGCTGG + Intergenic
1092661131 12:10739605-10739627 GGCAGGGAGAGGGAGGGTTCTGG - Intergenic
1092924595 12:13261821-13261843 GTCAGGGAGAGCTAGGATGGGGG + Intergenic
1093358682 12:18198802-18198824 GTCAGGGAGAGCTAGAGTGGGGG - Intronic
1093812609 12:23508051-23508073 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
1094315822 12:29137008-29137030 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
1095778417 12:46033833-46033855 GTCAGGGAGAGCTAGTGTGGGGG - Intergenic
1095806538 12:46325961-46325983 GTCAGGGAGAGCTAGTGTGGGGG + Intergenic
1097237947 12:57552482-57552504 GACAGGGAGGGCTAGGGTGAGGG - Intronic
1098629805 12:72710917-72710939 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1098653602 12:73004036-73004058 ATCAGGGAGAGCTAGGGTGAGGG + Intergenic
1099762817 12:86942492-86942514 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
1099835878 12:87909424-87909446 ATCAGGGAGAGCTAGGGTGGGGG + Intergenic
1102258573 12:111429972-111429994 GGCAGGCAGAGCTCAGGTCCTGG + Intronic
1103518244 12:121521171-121521193 GGGAGGGAGAGCGAGCGTGCAGG + Intronic
1108202918 13:48060066-48060088 GTCAGGGAGGGCTAGGGTGATGG - Intronic
1109343824 13:61092215-61092237 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1110650267 13:77935352-77935374 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1112237051 13:97645986-97646008 GTCAGGGAGAGCTCGGGTGGGGG - Intergenic
1112848712 13:103676626-103676648 GGCATGGAGAGCAAAGGTTCAGG - Intergenic
1113364301 13:109661882-109661904 GGCAAGGAGGGCTTCGGTGTAGG + Intergenic
1114549715 14:23525773-23525795 GGCAGGGACAGCACAGGTGCAGG + Exonic
1116179902 14:41519637-41519659 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1116702170 14:48257404-48257426 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1117920553 14:60722819-60722841 GGCAGGGAGAGCTACGGTGCCGG + Intronic
1118597428 14:67446677-67446699 GGGAGGGAGAGCCACTATGCTGG + Intergenic
1120251167 14:82063108-82063130 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1120618465 14:86735010-86735032 GTCAGGGAGAGCTAGGGTTGGGG - Intergenic
1120659707 14:87236893-87236915 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
1120881323 14:89417112-89417134 GGCGGGGAGAGCGGCGGGGCCGG - Intronic
1121353811 14:93196212-93196234 ACCAGGGAGAGCCACCGTGCTGG + Intronic
1121690786 14:95876211-95876233 GGGAGGGGGAGCTCCAGTGCGGG - Intergenic
1122102474 14:99424428-99424450 GGCGGGGAGAGCCAGGCTGCTGG + Intronic
1122499674 14:102188417-102188439 GGCAGGCAGGGCTATGGTGAAGG + Intronic
1123048682 14:105530459-105530481 GGCCAGGACACCTACGGTGCTGG - Intergenic
1125606233 15:40941499-40941521 GGCTGGGAGAGCTGCGGCGAGGG - Intergenic
1126843998 15:52742437-52742459 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
1129716540 15:77855058-77855080 GGGAGGCAGAGCTGGGGTGCAGG - Intergenic
1130088079 15:80795337-80795359 GGCAGGGGATGCTATGGTGCTGG + Intronic
1130781291 15:87043339-87043361 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1131065202 15:89430199-89430221 GGCAGGGAGACCTTCAGAGCTGG - Intergenic
1131447961 15:92515193-92515215 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1131684932 15:94758159-94758181 GCCAGGGAGAGCTAGGATGGGGG - Intergenic
1132150413 15:99454641-99454663 GCCAGGGAGGGCCACAGTGCAGG - Intergenic
1132236881 15:100228821-100228843 GGCAGGGAGAGCTGGGGTTGGGG - Intronic
1132590737 16:725309-725331 GGCAGGGAAAGCTAAGGGGTGGG + Intronic
1133736706 16:8621633-8621655 GGTAGGTGGAGCCACGGTGCGGG + Intergenic
1135227136 16:20670755-20670777 AGAAGGGAGAGCTTCTGTGCAGG - Intronic
1136248794 16:28990152-28990174 GGCAGGGAGGGATACGGATCAGG - Intronic
1136513977 16:30756770-30756792 GGCAGGGTGAGCTCTAGTGCAGG - Intronic
1137603272 16:49770772-49770794 GGCTGGGAGAGCCACGTTGGTGG - Intronic
1138247678 16:55479464-55479486 GCCAGGGAGCGCTACGATGGAGG + Exonic
1139477019 16:67207828-67207850 GGCAGATGGAGCCACGGTGCAGG - Intronic
1141111964 16:81277183-81277205 GGCAGGGAGAGAGATGGTGTTGG + Intronic
1141912263 16:87068062-87068084 GCCACGGAGAGCTTCGGGGCTGG + Intergenic
1141970834 16:87481512-87481534 GGCAGGGAGAGAAACGGGGGGGG + Intronic
1142275450 16:89116390-89116412 GCCAGGCAGCGATACGGTGCTGG + Intronic
1142323074 16:89397424-89397446 GGCAGGGAGTGGTACGGCGCTGG - Intronic
1143612578 17:8027987-8028009 GGCATGTAGAGATACAGTGCGGG - Intergenic
1144563673 17:16342753-16342775 GGCAGGGAGAGCAAAGTTGCTGG + Exonic
1144789236 17:17848221-17848243 GGCACTGAGAGCTAGGGAGCAGG + Intronic
1144956799 17:19022782-19022804 GGCAGGCAGGGCCAGGGTGCTGG - Intronic
1145121294 17:20262647-20262669 GGAAGGGAGTATTACGGTGCTGG - Intronic
1147599027 17:41734422-41734444 GGCCGGGCGAGCTCCGGTGCGGG + Exonic
1149220741 17:54413202-54413224 GTCAGGGAGAGCTAGTGTGTGGG - Intergenic
1150067213 17:62121111-62121133 GGCTGGGAGAGCAAAGGTCCGGG + Intergenic
1151360569 17:73586219-73586241 GGCAGGGAGAGCTAGCCAGCAGG - Intronic
1152529540 17:80909197-80909219 GTCTGGGTGAGCTACAGTGCTGG + Intronic
1154286213 18:13059266-13059288 GGCAGTGAGAGTGACGGTGCTGG - Exonic
1155057882 18:22200840-22200862 GGCAGGGAGGGCTCCGCCGCGGG + Exonic
1155174055 18:23287739-23287761 GTCAGGGAGAGCTAGGGTGGGGG - Intronic
1155434045 18:25792660-25792682 GGCAGGGAGACCAACTGTGCAGG - Intergenic
1156237586 18:35219457-35219479 GTCATGGAGAGCTAGGGTGGGGG - Intergenic
1156302479 18:35847611-35847633 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1156493949 18:37513505-37513527 GGCATGGAGAGCTACTGGGCAGG + Intronic
1156958415 18:42994569-42994591 GTCAGGGAGAGCTAGGGTGGGGG - Intronic
1160976766 19:1796628-1796650 GGCCGGGTGAGCTGCGGGGCTGG + Intronic
1161697441 19:5777371-5777393 GGCAGGGAGGGGGACAGTGCAGG - Intronic
1161951625 19:7470899-7470921 GGCAGAGAGGGCCACGGGGCAGG + Exonic
1162320346 19:9967952-9967974 GACAGGGAGAGCTGAGGTCCTGG + Intronic
1162534099 19:11253130-11253152 GGCAGGGAAAGCTGAGGTGGGGG - Intronic
1162826808 19:13257565-13257587 GGCAGGGAGAGGGAAGGGGCAGG + Intronic
1163579706 19:18130991-18131013 GGCAGGGAGATGTATGGTTCAGG + Intronic
1166876813 19:45902512-45902534 GGCAGGGAGAGCGAAGGTCGCGG + Intronic
1167069511 19:47212189-47212211 GACTGGGAAAGCTGCGGTGCGGG + Intergenic
1167116684 19:47492739-47492761 GCCAGGGAGAGAGACGGTGCTGG + Intronic
925803361 2:7624642-7624664 GGAAGGGAGAGCTACTGTTGGGG - Intergenic
926046636 2:9714923-9714945 AGCAGGGAGAGCTCGGGTGATGG + Intergenic
927214209 2:20657632-20657654 TGCAGGGGGAGCTCCGGAGCTGG + Intergenic
928121945 2:28590150-28590172 GGCAGGCAGAGCTGGGGTGAGGG - Intronic
929004613 2:37383020-37383042 GTCAGGGAGACCTAGGGTGGGGG + Intergenic
930098812 2:47587500-47587522 GTCAGGGAGAGCTAGTGTGGGGG + Intergenic
930487134 2:52024127-52024149 GTCAGGCAGAGCTAGGGTGGGGG + Intergenic
931948482 2:67335292-67335314 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
932159206 2:69445506-69445528 GTCAGGGAGAGCTAACGTGGGGG + Intergenic
934662087 2:96148465-96148487 GGGAGGGAGACCTGCTGTGCAGG - Intergenic
935657615 2:105438440-105438462 AGCAGGGACAGCTGCTGTGCAGG + Intronic
937153184 2:119700013-119700035 GGCAGGGAGAGCTCATGTGTGGG - Intergenic
937443817 2:121939465-121939487 GGCAGGGAGAGAGGCAGTGCAGG + Intergenic
938079665 2:128362977-128362999 GGCTGAGTGAGCTGCGGTGCAGG + Intergenic
938943414 2:136189024-136189046 GGCAGGGAGAGCTTGGATGTGGG + Intergenic
939708437 2:145483864-145483886 AGCAGGGAGAGCTGAGGTGATGG + Intergenic
940107572 2:150116293-150116315 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
940168392 2:150800285-150800307 AGCAGGGAAACCTACAGTGCAGG - Intergenic
941455943 2:165712354-165712376 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
941922222 2:170862678-170862700 GGCAGGGAGAGCAAGGCTGACGG + Intergenic
941935667 2:170979660-170979682 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
943450363 2:188036919-188036941 GTCAGGGAGAGTTAGGGTGGGGG - Intergenic
943951072 2:194132906-194132928 GTCAGGGAGAGCTAGGGTCGGGG + Intergenic
945173704 2:207021097-207021119 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
945301228 2:208218090-208218112 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
945382837 2:209161681-209161703 GACAAGGAGTGCTAGGGTGCAGG - Intergenic
946336220 2:219038426-219038448 GGCAGGGATGGCCACTGTGCTGG + Exonic
946426679 2:219602155-219602177 GGCAGGGAGAGCTGCAGAGAGGG - Intronic
946780822 2:223191855-223191877 GTCAGGGAGAGCTAGGGTTGGGG + Intronic
947263664 2:228252469-228252491 GGCAGGGAGAGCTACTTAGAGGG - Intergenic
948631047 2:239302957-239302979 GGCAGGGAGAGGAAAGGTGTGGG + Intronic
948644229 2:239393646-239393668 GGTAGGGAGAGCCGTGGTGCAGG - Intronic
1168804547 20:664591-664613 GACAGGAAGAGCTGAGGTGCAGG - Intronic
1169021921 20:2336555-2336577 GGCAGGGGGATCTAGGATGCTGG + Intronic
1171366934 20:24631330-24631352 GTCAGGGTGAGCTCCGGGGCAGG + Intronic
1172932219 20:38594567-38594589 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1173225989 20:41162774-41162796 GGCAGGCAGAGCTGGGGTGTGGG - Intronic
1173763554 20:45586226-45586248 GTCAGGGAGAGCTAGGGTGTGGG + Intergenic
1174353630 20:49984371-49984393 GCCAGAGAGAGCAACGGTGGGGG - Intronic
1175227073 20:57450953-57450975 GGCCGGGTGAGCTGAGGTGCTGG + Intergenic
1176366113 21:6033917-6033939 GGCCGGGCGAGCTCCGGGGCAGG + Intergenic
1176413458 21:6461322-6461344 TGCAGGGAGAGCTACCCTGAAGG + Intergenic
1177030949 21:15981820-15981842 GTCAGGGAGAGCTGGGGTGGGGG + Intergenic
1177102899 21:16917682-16917704 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1177834181 21:26171019-26171041 GGCCAGGAGAGGGACGGTGCAGG + Intronic
1177840531 21:26230072-26230094 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1178692155 21:34759121-34759143 GGCAGGGAGATCTGGGGTGGGGG + Intergenic
1179507009 21:41847862-41847884 GGGAGGGAGAGCTAAGCTGGGGG + Intronic
1179650141 21:42803061-42803083 GTCAGGGAGAGCTAGCGTGGGGG + Intergenic
1179688955 21:43069645-43069667 TGCAGGGAGAGCTACCCTGAAGG + Intronic
1179757404 21:43504628-43504650 GGCCGGGCGAGCTCCGGGGCAGG - Intergenic
1179793427 21:43768617-43768639 GGCAGGGAGAGCTACGTGTGCGG - Intergenic
1181525338 22:23481512-23481534 GGCATGGAGAGCGTCAGTGCTGG - Intergenic
1182301546 22:29339988-29340010 GGCAGGAAGGGCTGTGGTGCAGG - Intronic
1182435528 22:30327107-30327129 GGCGGGGAGGGCTGCGGTGACGG - Intergenic
1183988506 22:41582811-41582833 GGCAGGGAGAGCCACCGAACAGG + Intronic
1184670276 22:46008538-46008560 GGCAGGGGCAGCTGAGGTGCTGG + Intergenic
1184843746 22:47068064-47068086 GGCAGGGAGAGCTGGGGAGAGGG + Intronic
950141811 3:10620904-10620926 GGGAGGCAGGGCTACTGTGCCGG - Intronic
950533814 3:13568235-13568257 GGCAGGGAAGGCTGCGGTGGAGG - Intronic
950575438 3:13829537-13829559 GGCAGGGAGAGCGGCGCTGTGGG + Intronic
951316093 3:21191217-21191239 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
951762562 3:26162396-26162418 GTCAGGGAGAGCTAGTGTGGGGG + Intergenic
952894970 3:38072521-38072543 GTCAGGGAGAGCTAGAGTGGGGG + Intronic
953729278 3:45431081-45431103 GGCAGGGAGAGATACGGACTCGG - Intronic
953820395 3:46203165-46203187 GGCTGGGAGAGCCAGGCTGCTGG + Exonic
954690433 3:52392735-52392757 GGCAGGGAGAGGTGGGGGGCAGG - Intronic
955253598 3:57307356-57307378 GTCAGGGAGAGCTAGGGTGGGGG - Intronic
955851771 3:63227687-63227709 GGCAGGGAGAGGAAAGGTGAAGG + Intergenic
955856343 3:63277862-63277884 GGCAGGCAGTGCTTAGGTGCTGG - Intronic
956548769 3:70436882-70436904 GTCAGGGAGAGCTAAGGTGGGGG + Intergenic
957059692 3:75472095-75472117 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
958751230 3:98194784-98194806 GTCAGGGAGAGCTAGAGTGGGGG - Intronic
961210451 3:125121066-125121088 GGCAGGGAAAGCTGCTGAGCAGG - Intronic
961293712 3:125867284-125867306 GTCAGGGAGAGCTAGGGTAGGGG - Intergenic
961629530 3:128285772-128285794 GGCAGGGAGTGGCAGGGTGCTGG - Intronic
962751199 3:138435642-138435664 GGCTGGGAGACCGACGGCGCCGG + Intronic
963520662 3:146357243-146357265 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
963521847 3:146365746-146365768 GTCAGGGAGAGGTACGGTGGGGG - Intergenic
964300031 3:155277202-155277224 GTCAGGGAGAGCTAGGATGGGGG + Intergenic
964983833 3:162716081-162716103 GTCAGGGAGAGCTAGGGCGGGGG - Intergenic
964984641 3:162724409-162724431 GTCAGGGAGAGCTAGGGCGGGGG + Intergenic
965262428 3:166502801-166502823 GTCAGGGAGAGCTAGGATGGGGG + Intergenic
965336558 3:167434908-167434930 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
965624636 3:170674383-170674405 GTCAGGGAGAGCTAGAGTGGGGG + Intronic
965639785 3:170819816-170819838 GTCAGGGAGAGCTAGAGTGGGGG + Intronic
965861762 3:173157978-173158000 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
966067054 3:175831366-175831388 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
966085655 3:176065026-176065048 GTCAGGGAGAGCTGGGGTGGGGG - Intergenic
967624429 3:191668506-191668528 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
968148348 3:196318281-196318303 GGCAGGGAGGGCGGCTGTGCGGG - Exonic
969003598 4:4002281-4002303 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
969234894 4:5858835-5858857 TGCAGGGAGGCCCACGGTGCAGG - Intronic
969625054 4:8298071-8298093 GGCAGCGAGTGCCCCGGTGCTGG - Intronic
969810326 4:9642542-9642564 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
970029003 4:11655763-11655785 GTCAGGGAGAGCTGGGGTGGGGG + Intergenic
970087769 4:12367456-12367478 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
975093085 4:70426059-70426081 GGCAGAGAGAGCAACTGTGGTGG - Intergenic
976558790 4:86478272-86478294 GTCAGGGAAAGCTAGGGTGGGGG - Intronic
976719376 4:88155059-88155081 GTCAGGGAGAGCTAGGGTGGGGG + Intronic
977786259 4:101038207-101038229 GGCAGGGAGAGATGTGGTGAAGG - Intronic
978031705 4:103944826-103944848 GTCTGGGAGAGCTAGGGTGGGGG - Intergenic
979171184 4:117602335-117602357 ATCAGGGAGAGCTAGGGTGGGGG + Intergenic
980285166 4:130771053-130771075 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
982072280 4:151706001-151706023 GGGAGGGAGAGTTAAGGTGGAGG - Intronic
982413977 4:155110502-155110524 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
983345781 4:166524215-166524237 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
983448251 4:167879801-167879823 GTCAGGGAGAGCTATAGTGGGGG - Intergenic
983883538 4:172958388-172958410 GTCAGGGAGAGCTAGGGTGGGGG + Intronic
984098821 4:175463417-175463439 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
985057177 4:186046222-186046244 GTCAGGGAGAGCTAGGATGGGGG + Intergenic
985435935 4:189929544-189929566 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
985651524 5:1109869-1109891 GTCAGGAAGAGCTTGGGTGCTGG + Intronic
986410630 5:7475341-7475363 AGCAGGGAGAGGTCCTGTGCTGG + Intronic
986554824 5:9000566-9000588 GTCAGGGAGAGCTGGGGTGGGGG + Intergenic
988211108 5:28204964-28204986 GGCAGGGACAGCTGGGGTGAGGG + Intergenic
990317415 5:54596305-54596327 GGTGGGGAGAGCTATAGTGCTGG - Intergenic
996745211 5:126841574-126841596 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
997479720 5:134176376-134176398 GGGAGGGAGAGCTGCGGTGGTGG - Intronic
997595905 5:135107401-135107423 AGCAGGGCGTGCTGCGGTGCGGG - Intronic
998693478 5:144613373-144613395 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
999062961 5:148654718-148654740 AGCAGGGAGAGTTTGGGTGCAGG + Intronic
1002127250 5:177055601-177055623 GGCAGGGGGAGATACTTTGCCGG - Intronic
1002311713 5:178319052-178319074 GGCAGGTACAGCCATGGTGCAGG + Intronic
1003099992 6:3169719-3169741 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
1004377587 6:15104140-15104162 GGGAGAGAGAGCTAAGGTCCTGG + Intergenic
1004837227 6:19542593-19542615 GTCAGGGAGAGCTAGGATGGGGG - Intergenic
1005505801 6:26468094-26468116 GGCCGGGAGAGCTTCGCTTCAGG + Exonic
1006669764 6:35722711-35722733 GCCAGGCAGAGCAAGGGTGCAGG - Intronic
1007324121 6:41047446-41047468 GGCAGGTAGAGCTGCTGCGCAGG + Intronic
1007415231 6:41687724-41687746 GGCAGGGAGAGGGGCGGGGCAGG + Intronic
1007787595 6:44290031-44290053 GGCAGGGAGAGAGATAGTGCGGG + Intronic
1007924183 6:45638083-45638105 GGCAGGGAGAGGTATGTGGCAGG + Intronic
1008476815 6:51942192-51942214 GTCAGGGAGAGCTAAGGTTGGGG - Intronic
1010071497 6:71750574-71750596 GTCAGGGAGAGCTAGGGTGTGGG + Intergenic
1011367676 6:86600395-86600417 GTCAGGGAGAGCTAGGATGGGGG + Intergenic
1014115099 6:117661573-117661595 GTCAGGGAGAGCTAGTGTGGGGG + Intergenic
1015801159 6:137063345-137063367 GTCAGGGAGAGCGAGGGTGGGGG + Intergenic
1016204753 6:141456503-141456525 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
1018442235 6:163823867-163823889 GGCAGAGAGAGGAAGGGTGCTGG - Intergenic
1018899427 6:168043796-168043818 GGAAGGGAGAGCTAAGGGGGAGG - Intronic
1020357457 7:7292919-7292941 TGCAGGGAGAGACACGCTGCTGG - Intergenic
1021637571 7:22707096-22707118 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1021716820 7:23469203-23469225 GCCAGGGCGAGGGACGGTGCCGG - Intronic
1022572566 7:31469054-31469076 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1022709300 7:32836051-32836073 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
1023092337 7:36628729-36628751 GGCAGGGAGAGGCACTGGGCAGG + Intronic
1023991541 7:45131881-45131903 GGCTGGGGGAGCTGGGGTGCAGG - Intergenic
1024094733 7:45974637-45974659 GGCAGGGGGAGCTATGTGGCTGG - Intergenic
1025093424 7:56081020-56081042 GTCAGGGAGGGCTAGGGGGCAGG - Exonic
1025103687 7:56153575-56153597 GGCAGGGAGAGCTGAGATGTTGG - Intergenic
1027158566 7:75785779-75785801 GTCAGGGAGAGCTAGAGTGGGGG - Intronic
1027960551 7:84940148-84940170 GCCAGGGAGAGCGAGGCTGCAGG + Intergenic
1029172992 7:98643904-98643926 GGCAGGGACAGGCAGGGTGCAGG - Intergenic
1029388654 7:100259989-100260011 TGCAGGCAGAGCTGCTGTGCAGG + Intronic
1029500434 7:100925847-100925869 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1029548043 7:101221693-101221715 GGCAGGGAGAGCAGCCGAGCTGG + Intronic
1029708036 7:102285894-102285916 GGGAGGGAGGGCTTCGGTGGGGG - Intronic
1030441466 7:109594055-109594077 GTCAGGGAGAGCTAGGGTGAGGG + Intergenic
1031296834 7:120012569-120012591 GTCAGGGAGAGCTAGGCTGGGGG - Intergenic
1031422222 7:121565844-121565866 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
1033550378 7:142441599-142441621 GGCAGGGAAACCTACGGTGTGGG - Intergenic
1034685771 7:152970071-152970093 GGCAGTGAGAGCTTCAGTGCTGG - Intergenic
1034846561 7:154451549-154451571 GGCAGGGTCAGCTGCTGTGCTGG - Intronic
1035880447 8:3240238-3240260 GACAGGGAGAGCTAGGATGGGGG + Intronic
1036390127 8:8318119-8318141 GGAAGGGGCAGCGACGGTGCAGG + Exonic
1036639730 8:10575121-10575143 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic
1037317380 8:17611656-17611678 GGCTGGGAGAGCAAAGGAGCTGG + Intronic
1037822128 8:22140100-22140122 GGCAGGGTGAGCCAAGGAGCAGG + Intronic
1038581581 8:28753065-28753087 CGCAGGGAGGGCTGTGGTGCCGG + Exonic
1038828620 8:31033348-31033370 GGCGGGGAGAGCGACGGCGGGGG + Exonic
1048296409 8:133217829-133217851 GGTAGGGAAAGCCACTGTGCTGG + Intronic
1049868575 8:144956118-144956140 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
1050117837 9:2279250-2279272 GTCAGGGAGAGCTAGGGTGGCGG - Intergenic
1050257870 9:3813188-3813210 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1050325176 9:4491112-4491134 GATAGGGGGAGATACGGTGCGGG - Intronic
1053058246 9:35007173-35007195 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1053506263 9:38645983-38646005 GGAAGGCAGAGCTGTGGTGCGGG - Intergenic
1055626950 9:78184499-78184521 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1058612621 9:106792033-106792055 GTCAGGGAGAGCTAGGGTTGGGG - Intergenic
1059267836 9:113052265-113052287 GGCAGGGAGAGGGGTGGTGCAGG - Intronic
1059863265 9:118487693-118487715 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
1061159374 9:128884367-128884389 GGCATGGAGAGACACTGTGCTGG - Intronic
1062097268 9:134709888-134709910 GGCAGGCAGGGCTGCGGTGGAGG + Intronic
1062516967 9:136941686-136941708 TGCAGGGAGGGCTACGGTGAGGG + Intronic
1187390845 X:18885781-18885803 GGGAGGGAGGGGTACTGTGCTGG - Intergenic
1187475455 X:19607102-19607124 GGGAAGGATAGCTACAGTGCTGG - Intronic
1188431251 X:30107033-30107055 ATCAGGGAGAGCTAGGGTGGGGG - Intergenic
1188463163 X:30451138-30451160 GTCAGGGAGAGCTAGAGTGGGGG + Intergenic
1190362901 X:49666046-49666068 GACATGGAGAGCTAAAGTGCTGG - Intergenic
1194660906 X:96627719-96627741 GTCAGGGAGAGCTAGGATGGGGG - Intergenic
1196300222 X:114043672-114043694 GTCAGGGAGAGCTAGGGTGGGGG - Intergenic
1196783729 X:119404462-119404484 GGCAGGGTGAGGTAAGGGGCAGG + Intronic
1196992451 X:121345020-121345042 GTCAGGGAGAGCTAGGGTGGCGG + Intergenic
1197499936 X:127230280-127230302 GTCAGGGAGAGCTAGGGTGAGGG - Intergenic
1197662834 X:129192656-129192678 GGGATGGAGAGCTAGGGTACAGG - Intergenic
1198983535 X:142425591-142425613 GTCAGGGAGAGCTAGGGTGGGGG + Intergenic
1200052628 X:153443042-153443064 GGGAGGGAGAGCTATGGGCCTGG - Intergenic
1200813062 Y:7504425-7504447 GTCAGGGAGAGCTAGTGTGGGGG - Intergenic
1201240941 Y:11955652-11955674 GGCAGGGAAAGCTACAGGTCTGG + Intergenic
1201937370 Y:19422822-19422844 GTCAGGGAGAGCTAGAGTGGGGG - Intergenic