ID: 1117921449

View in Genome Browser
Species Human (GRCh38)
Location 14:60728947-60728969
Sequence CATCACTAAATAATAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117921449_1117921452 8 Left 1117921449 14:60728947-60728969 CCATCCATTATTATTTAGTGATG No data
Right 1117921452 14:60728978-60729000 CATGTAGTGAATATTTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117921449 Original CRISPR CATCACTAAATAATAATGGA TGG (reversed) Intergenic
No off target data available for this crispr