ID: 1117921513

View in Genome Browser
Species Human (GRCh38)
Location 14:60729547-60729569
Sequence AACTTGTACTGGAAGAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117921507_1117921513 14 Left 1117921507 14:60729510-60729532 CCCCAAAACACTCAGAATCTTTT No data
Right 1117921513 14:60729547-60729569 AACTTGTACTGGAAGAATTAAGG No data
1117921508_1117921513 13 Left 1117921508 14:60729511-60729533 CCCAAAACACTCAGAATCTTTTG No data
Right 1117921513 14:60729547-60729569 AACTTGTACTGGAAGAATTAAGG No data
1117921509_1117921513 12 Left 1117921509 14:60729512-60729534 CCAAAACACTCAGAATCTTTTGC No data
Right 1117921513 14:60729547-60729569 AACTTGTACTGGAAGAATTAAGG No data
1117921506_1117921513 30 Left 1117921506 14:60729494-60729516 CCAAGATGGGCACTTGCCCCAAA No data
Right 1117921513 14:60729547-60729569 AACTTGTACTGGAAGAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117921513 Original CRISPR AACTTGTACTGGAAGAATTA AGG Intergenic
No off target data available for this crispr