ID: 1117922347

View in Genome Browser
Species Human (GRCh38)
Location 14:60738495-60738517
Sequence TTTGGGAGGATCGAGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117922347_1117922353 -7 Left 1117922347 14:60738495-60738517 CCAGCCGCCTCGATCCTCCCAAA 0: 1
1: 0
2: 4
3: 50
4: 339
Right 1117922353 14:60738511-60738533 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1117922347_1117922358 22 Left 1117922347 14:60738495-60738517 CCAGCCGCCTCGATCCTCCCAAA 0: 1
1: 0
2: 4
3: 50
4: 339
Right 1117922358 14:60738540-60738562 CCACTGCGCCCGGCCTGAGATGG 0: 3
1: 13
2: 111
3: 602
4: 1903
1117922347_1117922356 12 Left 1117922347 14:60738495-60738517 CCAGCCGCCTCGATCCTCCCAAA 0: 1
1: 0
2: 4
3: 50
4: 339
Right 1117922356 14:60738530-60738552 CAGGTGTGAGCCACTGCGCCCGG 0: 4597
1: 31656
2: 91222
3: 129273
4: 133986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117922347 Original CRISPR TTTGGGAGGATCGAGGCGGC TGG (reversed) Intronic
900143161 1:1146928-1146950 TTTGGGAGGCTGGCGGGGGCAGG + Intergenic
900285453 1:1897275-1897297 TTTGGGAGGCTGGTGGCGGCGGG - Intergenic
901265123 1:7904220-7904242 TTTGGGAGGCCCAAGGCGGAAGG + Intergenic
901272471 1:7963305-7963327 TTTGGGAGGCCTGAGGCGGGTGG - Intronic
902137311 1:14320563-14320585 TTTGGTAGGATGGAGGATGCTGG - Intergenic
902327739 1:15713194-15713216 TTTGGGAGGCCCGAGGCAGGAGG - Intronic
902349818 1:15846361-15846383 TTTGGGAGGCTTGAGGCGGGTGG + Intergenic
903321107 1:22543669-22543691 GGTGGGAGGATGGAGGCTGCTGG - Intergenic
903878053 1:26489665-26489687 TTAGGGAGGATTGAGGCAGGAGG + Intergenic
904136604 1:28317425-28317447 TTTTGGGAGATCGAGGCGGGTGG + Intergenic
904175579 1:28626218-28626240 TATGGGAGGCCCGAGGCGGGTGG - Intronic
904831461 1:33308647-33308669 TTTGGGAGGCCCGAGACGGGAGG - Intronic
906128220 1:43440626-43440648 TGTGGGAGGAGCTAGGAGGCAGG - Intronic
906317552 1:44798055-44798077 TTTGGGAGGGCCGAGGTGGGTGG + Intergenic
906328653 1:44866153-44866175 TTTGGGAGGCTGGAGGTGGGCGG + Intronic
906358274 1:45128300-45128322 TTTGGGAGGCTGGAGGTGGGAGG - Intronic
906397148 1:45476262-45476284 TTTGGGAGGCCCGAGGCAGGTGG + Intronic
908997821 1:70179236-70179258 TTTGGGAGGCCCGAGGTGGGCGG + Intronic
909054689 1:70807162-70807184 TTTGGGGGGGTCGAGGAAGCAGG + Intergenic
909468389 1:76000153-76000175 TTTGGGAGGGCTGAGGCGGGTGG + Intergenic
909930657 1:81495278-81495300 TTTGGGAGAAGGGAGGCAGCTGG - Intronic
910281196 1:85503442-85503464 TTTGGGAGGCCCGAGGTGGGTGG - Intronic
913160531 1:116141081-116141103 TCTGGGAGGAAGGAGGCTGCTGG - Intergenic
914735348 1:150411215-150411237 TTTGGGAGGTCCAAGGCGGGTGG + Intronic
914837969 1:151223743-151223765 TTTGGGAGGCTTGAGGTGGATGG + Intronic
915487685 1:156233398-156233420 TTTGGGAGGGCCGAGGTGGGTGG - Intronic
915509776 1:156380341-156380363 TTTGGGAGGCTCGAGGCAGGCGG - Intronic
916315415 1:163443127-163443149 TTTGGGAGGACTGGGACGGCCGG - Intergenic
916390460 1:164325142-164325164 TTTGGGAGGCCTGAGGCGGGCGG + Intergenic
916889168 1:169100031-169100053 TTTGGGAGGAGCTGGGAGGCAGG - Intergenic
917342289 1:173992388-173992410 TTTGGGAGGGCCAAGGCGGGTGG - Intronic
917392360 1:174552321-174552343 TTTTGGAGGGTGGAGGCGGAGGG - Intronic
917514826 1:175698595-175698617 TTTGGGAGGCAAGAGGCGGGTGG + Intronic
917753564 1:178076868-178076890 TTTGGGAGGAATGAGGCAGGAGG - Intergenic
918620255 1:186595389-186595411 TTTGGGAGGCCCGAGGCGGGTGG + Intergenic
920001244 1:202800581-202800603 TTTGGGAGGCTCCAGGCAGGAGG - Intronic
920082826 1:203388480-203388502 TTTGGGAGGCCCGAGGTGGTTGG - Intergenic
920160289 1:203992371-203992393 TTTGGGAGGCCCGAGGCAGGTGG - Intergenic
921009417 1:211126265-211126287 TTTGGGAGGCCTGAGGCGGGCGG + Intronic
921089477 1:211830137-211830159 TGTGGAAGGGTCGTGGCGGCGGG + Intronic
921663802 1:217841678-217841700 TTTGAGAGGATTGAGGTGGGAGG + Intronic
921706988 1:218333739-218333761 TTTGGGAGGCAAGAGGCGGGGGG - Exonic
922436387 1:225611560-225611582 TTTGGGAGGCTCGAGGCAGGTGG - Intronic
922651721 1:227345987-227346009 TTTGGGAGGCTTGAGGCAGGCGG + Intergenic
924381093 1:243465184-243465206 TTTGGGAGGGTCGGGGCTGGTGG + Intronic
924441203 1:244086949-244086971 TTTGGGAGGGCCGAGGTGGGAGG - Intergenic
924812031 1:247411439-247411461 TTTGGGAGGTTTGAGGCAGGAGG - Intergenic
1063211477 10:3884907-3884929 CTTTGGAGGGTCGAGGCGGGTGG + Intergenic
1063417642 10:5887625-5887647 TTTGGGAGGCCGGAGGCGGGTGG - Intronic
1065734452 10:28738872-28738894 TTTGGGAAGATGAAGGAGGCTGG + Intergenic
1066189068 10:33038713-33038735 TTTGGGAGGCTGGAGGCTGGAGG + Intergenic
1066587457 10:36951971-36951993 ATTGGGAGGAGCGAAGGGGCTGG + Intergenic
1066678467 10:37913347-37913369 TTTGGGAGGCTGGGGGCGGGTGG - Intergenic
1067121219 10:43473780-43473802 TTTGGGAGGCTTGAGGTGGGAGG + Intronic
1068029866 10:51693042-51693064 TTTGGGAGGGCCAAGGCGGGTGG + Intronic
1068832220 10:61508420-61508442 TTTGGGAGGCCCGAGGCGGGCGG + Intergenic
1069524927 10:69161302-69161324 TTTGGGAGGCCCAAGGCGACAGG - Intronic
1070200251 10:74197454-74197476 TTTGGGAGGCCCAAGGCGGGTGG + Intronic
1070643348 10:78184652-78184674 TTTGAGAGGAGAGAGGAGGCTGG + Intergenic
1070954221 10:80454105-80454127 TGGGGGAGGGGCGAGGCGGCTGG + Intergenic
1071416488 10:85446474-85446496 TTTGGGAGGCCAGAGGCGGTTGG + Intergenic
1071538770 10:86459869-86459891 TTTGGGAGGCTGAAGCCGGCAGG + Intronic
1073234641 10:102003403-102003425 TTTGGGAGGCCCGAGGTGGGTGG - Intronic
1073366898 10:102950516-102950538 TTTGGGAGGCTTGAGGCGGGAGG + Intronic
1074319051 10:112383948-112383970 TTTGGGAGGCTTGAGGCAGGTGG + Intronic
1074446837 10:113527629-113527651 TTTTGGAGGAACGAGGCCCCAGG - Intergenic
1079055618 11:17204099-17204121 CTTTGGAGGATCGAGGCAGGAGG - Intronic
1079461559 11:20684161-20684183 TTTGGGAGGTTTGAGGCAGGAGG + Intronic
1080461560 11:32459177-32459199 TTTGGGAGGACAGAGGCAGAAGG - Intergenic
1080521965 11:33075450-33075472 TCTGGGAGGCCCGAGGCGGATGG - Intronic
1080551573 11:33376923-33376945 TTCTGGAGGAGCGGGGCGGCGGG + Intergenic
1081272343 11:41100322-41100344 TTTGGGAGGCCCGAGGTGGGTGG + Intronic
1082156559 11:48825495-48825517 TTTGGGAGGTTTGAGGCGTATGG + Intergenic
1083577657 11:63803904-63803926 TTCGGGAGGCCCGAGGCGGGTGG - Intergenic
1083773942 11:64884042-64884064 TTTGGGGGGATGGAGGAGGGAGG - Intronic
1084451239 11:69240011-69240033 TTTGGGAGGCCCGAGGCAGGCGG + Intergenic
1084752528 11:71213743-71213765 TCTGTGTGGATGGAGGCGGCAGG - Intronic
1084977685 11:72811853-72811875 TTTGGGAGGCTTGAGGCGGGTGG + Intergenic
1085274947 11:75292381-75292403 TTTGGGAGGCTGGAGGTGGGAGG - Intronic
1086808720 11:91277272-91277294 TTTGGGAGTGTCTAGGCGGGCGG - Intergenic
1087287174 11:96277506-96277528 TTTGGGAGGGCCGAGGCAGGTGG + Intronic
1089232909 11:116995504-116995526 TTTGGGAGGGTTGAGGTGGGTGG - Intronic
1089519208 11:119052514-119052536 TTTGGGAGGATGGTAGCGGGAGG + Intronic
1090040556 11:123287230-123287252 TTTGGGGGGATGGAGGAGGCAGG + Intergenic
1090295700 11:125585957-125585979 TTTGGGAGGCTCAAGGCAGGTGG + Intergenic
1090937222 11:131353906-131353928 TTTGGGAGGGTCCTGGTGGCAGG + Intergenic
1092843573 12:12564678-12564700 TTTGGGAGGCCCGAGGCGGGTGG + Intergenic
1092919828 12:13221542-13221564 TTTGGGAGGGCCGAGGTGGGTGG - Intergenic
1093047030 12:14458577-14458599 TTTGGGAGGCCCGAGGCAGGTGG + Intronic
1093176006 12:15914136-15914158 TTTGGGAGGCTCAAGGCAGCCGG + Intronic
1093241893 12:16686949-16686971 CTTTGGAAGATCGAGGCGGGTGG + Intergenic
1093472074 12:19512717-19512739 TTTGGGAGGCTGGGGGAGGCCGG + Intronic
1094599301 12:31894467-31894489 TTTGGGAGGCTGGAGGCAGGTGG - Intergenic
1095604032 12:44045599-44045621 TTTGGGAGGCTTGAGGCGGTTGG + Intronic
1096126959 12:49126713-49126735 TTTGGGAGGCTTGAGGCGGGTGG - Intergenic
1097164723 12:57077838-57077860 TTTGGGAGGGCCAAGGCGGATGG + Intronic
1098102216 12:67029955-67029977 TTTGGGAGGGCCAAGGCGGGTGG + Intergenic
1098719639 12:73880566-73880588 TTAGGGAGGCTTGAGGCGGACGG - Intergenic
1100272750 12:93042126-93042148 TTTGGGAGGCCCGAGGTGGGTGG - Intergenic
1100797559 12:98198372-98198394 TTTTGGAGGATGGAGGGAGCTGG - Intergenic
1101010704 12:100446293-100446315 TTTGGGAGGCCCGAGGCAGGTGG + Intergenic
1101502457 12:105316793-105316815 TTTGGGAAGGTCGAGGTGGGAGG + Intronic
1101759827 12:107649422-107649444 TTTGGGAGGACTGAGGAGTCAGG - Intronic
1102110623 12:110363263-110363285 TTTGGGAGGCCCGAGGCAGGCGG + Intergenic
1102118739 12:110424147-110424169 TTTAGGAGGTTCGAGGCGGGTGG - Intergenic
1102362278 12:112298567-112298589 TTTGGGAGGCTTGAGGCAGGAGG - Intronic
1102585737 12:113921729-113921751 TTTTGGAGGCTCGAGGCTGCAGG + Intronic
1102734968 12:115151298-115151320 TTTGGGAGGCCCGAGGTGGGTGG - Intergenic
1103577096 12:121886036-121886058 TTTTGGGAGACCGAGGCGGCTGG - Intergenic
1104338343 12:127922417-127922439 TTTGGGAGGTTTGAGGCAGGGGG - Intergenic
1105825803 13:24121858-24121880 TTTTGGGGGATCGAGGGGGATGG - Intronic
1105908079 13:24834161-24834183 TTTGGGAGGTCAGAGGCGGGTGG + Intronic
1105936166 13:25101426-25101448 TTTGGGAGGCTTGAGGCAGAAGG - Intergenic
1106264777 13:28100358-28100380 GCGGGGAGGAGCGAGGCGGCTGG + Intronic
1106271488 13:28158633-28158655 TTTGGGAGGCTGGAGGCAGGTGG + Intronic
1107170919 13:37341418-37341440 TTGGAGAGGATTGAGGCAGCAGG - Intergenic
1107908217 13:45081734-45081756 TTTGGGAGGCCCAAGGCGGGTGG + Intergenic
1107936796 13:45352119-45352141 TTTGGGAGGCCCGAGGTGGGCGG - Intergenic
1110628114 13:77674476-77674498 TGTGGGAGGAGAGAGGTGGCAGG + Intergenic
1112565518 13:100548605-100548627 TTTGGGAGGATCAAGTCCCCTGG + Intronic
1113485276 13:110648499-110648521 TTTGGGAAGATGGAGGGGGACGG - Intronic
1113883787 13:113646662-113646684 TTTGGAAGGATGGAGGGGCCTGG + Intergenic
1114488851 14:23083311-23083333 TTTGGGAGGACCGGGGTGGGAGG - Intronic
1115096452 14:29642144-29642166 TTTGGGAGGCTCGAGGCAGGTGG - Intronic
1115857964 14:37651676-37651698 CTTGGGAGGCTTGAGGCGGGCGG + Intronic
1116329151 14:43574401-43574423 TTTGGGAGGCTTGAGGCTGGTGG + Intergenic
1116817431 14:49597298-49597320 TTTGGGAGGCTCGAGGCAGGAGG - Intronic
1117154747 14:52927510-52927532 TTTGGGAGGTTTGAGGTGGGTGG + Intronic
1117298104 14:54397097-54397119 GTTTGGAGGAGCGAGGCGGCAGG + Intronic
1117922347 14:60738495-60738517 TTTGGGAGGATCGAGGCGGCTGG - Intronic
1119200381 14:72747542-72747564 TTTGGGAGGCCCGAGGCAGGAGG + Intronic
1122015047 14:98788098-98788120 TTTGTAAGGATAGAGACGGCGGG - Intergenic
1122144230 14:99679585-99679607 TTTGGGAGGTTCAAGGAAGCTGG + Exonic
1122436562 14:101705206-101705228 TTTGGGAGGCTCGAGGCGGGCGG - Intergenic
1122950190 14:105039978-105040000 TTTGGGAGGACCGAGGTGGGCGG + Intergenic
1124054945 15:26233677-26233699 TTTGGGAGGATGAAGCAGGCAGG - Intergenic
1124068706 15:26371034-26371056 TTTGGGAGGCTTGAGGAGGAAGG + Intergenic
1124454944 15:29833633-29833655 TTTGGGAGGTTAGAGCAGGCAGG - Intronic
1125504585 15:40259541-40259563 TTTGGGAGGCTGAAGGCGGGTGG + Intronic
1127371965 15:58349683-58349705 TTTGGGAGGCCCGAGGCGGGTGG - Intronic
1128573397 15:68752298-68752320 TTTGGGAGGCCCGAGGTGGGTGG - Intergenic
1129969691 15:79767354-79767376 TTGGGGAGGTTAGAGGCAGCGGG + Intergenic
1130547879 15:84869639-84869661 TCTGGAAGGATCCAGGCTGCTGG - Exonic
1134440279 16:14295616-14295638 TTTGGGAGGCTCGAAGCAGGTGG - Intergenic
1134484608 16:14647451-14647473 CTTGGGAGGACCGAGGCAGGCGG + Intronic
1134605985 16:15571595-15571617 TTTGGGAGGCTTGAGGTGGGTGG - Intronic
1135706577 16:24680184-24680206 TTTGGGAGGCTGAAGGCGGGAGG + Intergenic
1136634414 16:31510491-31510513 TTTTGGAAGACCGAGGCGGGAGG - Intergenic
1139732171 16:68955905-68955927 TTTGGGAGGCCCGAGGCTGGAGG + Intronic
1139740121 16:69028201-69028223 TTTGGGAGGCCCGAAGCGGATGG - Intronic
1139836917 16:69846475-69846497 TTTGGGGAGGTCGAGGCGGATGG + Intronic
1142164062 16:88576141-88576163 TTTGGGAGGCCCGAGGCAGGTGG - Intronic
1142654141 17:1379240-1379262 TTTGGGAGGATGAAGCGGGCAGG + Intronic
1142674642 17:1506265-1506287 TTTGGGAGGGCCGAGGCAGGTGG - Intronic
1142704509 17:1686009-1686031 TTTGGGAGGGCCGAGGCAGGAGG - Intergenic
1143545843 17:7594838-7594860 TTTGGGAGGCTGGAGGCAGGTGG + Intronic
1143905816 17:10208228-10208250 TTTGGGAGGCTGGAGGCAGGTGG + Intergenic
1143948651 17:10616078-10616100 TTTGGGAGGCTTGAGGCTGGAGG + Intergenic
1143977802 17:10843290-10843312 TTTGGGAGGCCTGAGGCGGGTGG - Intergenic
1144471169 17:15542716-15542738 TTTGGGAGGGCCAAGGCGGGCGG - Intronic
1144925297 17:18801977-18801999 TTTGGGAGGGCCAAGGCGGGCGG + Intronic
1145059921 17:19726269-19726291 TTTGGGAGGCCCGGGGCGGGTGG - Intergenic
1145085313 17:19933260-19933282 CTTTGGAAGATCGAGGCGGGTGG - Intronic
1145102611 17:20089381-20089403 TTTGGGAGGCTTGACGCGGGAGG + Intronic
1145232010 17:21180007-21180029 TTTGGGAGGCCCCAGGCGGGTGG - Intronic
1146388255 17:32396969-32396991 TTTGGGAGGCTTGAGGTGGGCGG + Intergenic
1147248267 17:39136489-39136511 TTTGGGAGGCTCGAGGTGGGAGG - Intronic
1147404840 17:40203799-40203821 TTTGGGAGGCCTGAGGCGGGCGG + Intergenic
1147808554 17:43150030-43150052 TTTGGGAGGCTTGAGGTGGGTGG - Intergenic
1148900318 17:50870680-50870702 TTTAGGAGGCTTGAGGCGGGAGG + Intergenic
1150177924 17:63081920-63081942 TTTGGGAGGCCCAAGGCGGGTGG + Intronic
1150187388 17:63198436-63198458 TTTGGGAGGCTTGAGGCAGGCGG - Intronic
1150232570 17:63565027-63565049 TTTGGGAGGACCAAGGTGTCAGG + Intronic
1151139153 17:71975356-71975378 TTTGGGAGGGTCCAGCTGGCCGG + Intergenic
1151174291 17:72274384-72274406 TGTGGGAGGATGGTGGGGGCAGG + Intergenic
1152970941 18:160058-160080 TTTGGGAGGCTCGAGGCGGGCGG + Intronic
1153043933 18:838671-838693 TTTGGGAGGCCCAAGGCGGGTGG - Intergenic
1153682262 18:7511830-7511852 TTTGGGAGGATGGAGATGGGTGG + Intergenic
1156469467 18:37368378-37368400 GTGGGGAGGATCAAGGCGGAGGG - Intronic
1159483178 18:69017366-69017388 TTTGGGAAGCTCGAGGCTGGTGG - Intronic
1159942497 18:74419054-74419076 TTTGGGAGCAGCGAGGCAGGAGG - Intergenic
1160689239 19:453513-453535 TTTTGGAAGACCAAGGCGGCAGG - Intronic
1161438845 19:4279425-4279447 TGGGGCCGGATCGAGGCGGCGGG + Exonic
1162505032 19:11078612-11078634 TTTGGGAGGCCCGAGGCAGGCGG - Intergenic
1162569458 19:11462713-11462735 TTTGGGAGGCTTGAGGGGGGTGG + Intronic
1162712398 19:12605236-12605258 TTTGAGAGGAGCGAGGTGGGAGG + Intronic
1163869600 19:19808601-19808623 TTTGGGAGGCACGAGGTGGGCGG + Intronic
1164029359 19:21387430-21387452 TTTGGGAGGCCCGAGGTGGGCGG - Intergenic
1164228908 19:23270655-23270677 TTTGGGAGGTTGGAGGTGGACGG - Intergenic
1164620102 19:29690340-29690362 TTTGGGAGGCCCGAGGCGGGGGG + Intergenic
1166767826 19:45263006-45263028 TTTGGGAAGACCAAGGCGGGAGG - Intronic
1166788550 19:45384006-45384028 TTTGGGAGGCTCGAGGCGGGCGG - Intronic
1167358031 19:49016001-49016023 TGTGGGAGGATCGGGGTGTCAGG + Exonic
1167398147 19:49245260-49245282 TTTGGGAGGGCCGAGGCAGGCGG - Intergenic
1168139056 19:54372885-54372907 TTTTGGAAGGTCGAGGCGGATGG + Intergenic
1168151343 19:54450466-54450488 TCAGGGAGCATCGAGGGGGCTGG - Intronic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
1168464581 19:56591370-56591392 TTTGGGAGGCTGGAGGCGGGTGG + Intergenic
926999118 2:18773860-18773882 TTTGGGAGGATCACAGCGTCAGG + Intergenic
927111109 2:19864337-19864359 TTTGGGAGGCCCCAGGCGGGCGG - Intergenic
928059781 2:28100205-28100227 TTTGGGAGGCTGGGGGCGGGTGG + Intronic
928306506 2:30174264-30174286 TTTGGGAAGACCGAGGTGGGAGG - Intergenic
928532375 2:32205909-32205931 TTTAGGAGGTTCAAGGCGGGTGG - Intronic
929206527 2:39301779-39301801 TTCGGGAGGGCCGAGGCGGGCGG + Intronic
929352976 2:40983146-40983168 TTTGGGAGGCTGGAGGCAGGCGG + Intergenic
929404509 2:41626105-41626127 TTTGGGAGGCTTGAAGCGGGTGG + Intergenic
930079711 2:47435762-47435784 TTTGGGAGGTCCGAGGTGGGTGG - Intronic
932413670 2:71561367-71561389 TCTAGGAGGATCCAGGAGGCAGG + Intronic
932967699 2:76496919-76496941 TTTGAGAGGATGGAGGCAGGAGG - Intergenic
933673068 2:85027616-85027638 TTTGCGGGGGTCGAGGCGGGTGG - Intronic
934522102 2:95025987-95026009 TCTGGGAGCATCGGGGCAGCAGG + Intronic
934530537 2:95084767-95084789 TTTGGGAGGCCCGAGGCAGGCGG - Intergenic
934775863 2:96937136-96937158 TTTGGGAGGACAGAGGCAGGAGG - Intronic
937117184 2:119416130-119416152 TTTGGGAGGCTTGAGGTGGGAGG + Intergenic
937263780 2:120603267-120603289 TTTGGGAGGGCTGAGGCGGGTGG - Intergenic
937282603 2:120730612-120730634 TTTGGGAGGCCTGAGGCGGGTGG - Intergenic
938227206 2:129626297-129626319 TTTGGGAGGCTGGAGTCGACAGG + Intergenic
940227396 2:151414067-151414089 TTTGGGAGGCCTGAGGCGGGTGG + Intronic
941028443 2:160484626-160484648 TTTGGGAGGCCCGGGGCGGGCGG + Intronic
941101131 2:161296715-161296737 TTTGGGAGGGCCGAGGGGGGTGG - Intergenic
941944096 2:171075973-171075995 TTTGGGAGGATGAAGTGGGCAGG + Intronic
944794013 2:203163573-203163595 TTTGGGAGGATGAAGGAGGAAGG - Intronic
945446654 2:209946259-209946281 TTTGGGAGGCTTGAGGCAGGAGG + Intronic
946553994 2:220834313-220834335 TTTGGGAGGCTGAAGGCGGGTGG + Intergenic
947119282 2:226799299-226799321 TTTGGGCGGCTGGTGGCGGCTGG - Exonic
947538422 2:230956408-230956430 TTTGGGAGGCTGGAGGCGGGTGG - Intronic
1168759411 20:339214-339236 TTTGGGAGGCTGGAGGCAGGTGG - Intergenic
1169452448 20:5723569-5723591 TTTGGGAGGGCCGAGGCAGGTGG + Intergenic
1172144553 20:32747131-32747153 TTTGGGAGGCTCGAGGCGGGCGG + Intergenic
1172424031 20:34842970-34842992 TTTGGGAGGCACGAGGCGGGCGG - Intergenic
1174516166 20:51094015-51094037 TTTGGGAGGCCCGAGGTGGGTGG + Intergenic
1174546287 20:51327794-51327816 TTTGGGAGAACCAAGGCGTCTGG + Intergenic
1174620595 20:51871681-51871703 TTTGGGAGGCTGGAGGCAGGAGG - Intergenic
1174797932 20:53538082-53538104 TTTGGGAGGTTGGAGGTGGGCGG + Intergenic
1174813482 20:53666995-53667017 TTTGGGAAGGCCGAGGCGGGTGG - Intergenic
1175373407 20:58508283-58508305 TTAGGGAGGATAGTGGCTGCTGG - Intronic
1175886313 20:62293103-62293125 TTTGGGAGGCTGGAGGCAGGCGG - Intronic
1179771974 21:43627112-43627134 TTTGGGAGGCTTGAGGCGGGTGG - Intronic
1180597491 22:16988280-16988302 TCTGGGAGGACAGAGGAGGCAGG - Intronic
1180831685 22:18910026-18910048 GGTGGGAGGATGGAGGAGGCTGG + Intronic
1180869334 22:19137578-19137600 TTTCGGAGGATGGAGGTGCCAGG - Intronic
1180965336 22:19785150-19785172 TTTGGGAGGCTAGAGGCGGGAGG + Exonic
1181068165 22:20316343-20316365 GGTGGGAGGATGGAGGAGGCTGG - Intronic
1181271955 22:21664277-21664299 TTTGGGAGGGCTGAGGCGGGAGG + Intronic
1181471177 22:23141085-23141107 TTTGGGAGGCCCGAGGCAGGCGG + Intronic
1182006217 22:26961781-26961803 TTAGGAAGGATGGAGTCGGCGGG + Intergenic
1182360988 22:29746390-29746412 TTTGGGAGGTTTGAGGTGGGTGG - Intronic
1183466723 22:37983831-37983853 TTTGCGAGGACCCCGGCGGCTGG - Exonic
1183824182 22:40371940-40371962 TTTGGGAGGCCCGAGACGGGCGG - Intronic
1183877907 22:40799601-40799623 TTTGGGAGGCCTGAGGCGGGTGG - Intronic
1184713536 22:46267693-46267715 GAAGGGAGGATGGAGGCGGCGGG + Intergenic
1184756903 22:46521571-46521593 TTTGGGAGGCTTGAGGCAGGCGG + Intronic
1184914413 22:47559269-47559291 TATGGGAAGATCCAGGAGGCAGG + Intergenic
1203281765 22_KI270734v1_random:135297-135319 GGTGGGAGGATGGAGGAGGCTGG + Intergenic
949900156 3:8807494-8807516 TTTGGGAGGCCCGAGGTGGGTGG + Intronic
950057003 3:10033166-10033188 TTTGGGAGGCTCGAGGCAGGCGG + Intronic
951307543 3:21084067-21084089 TTTGGGAGGCCCGAGGCGGGTGG + Intergenic
951509450 3:23485337-23485359 TTTGGGAGGACCGAGGTGGGTGG - Intronic
953691706 3:45125240-45125262 TTTGGGTGGGTAGAGGAGGCTGG + Intronic
954204196 3:49045834-49045856 TTTGGGAGGCTCAAGGCAGGAGG - Intronic
955319731 3:57965614-57965636 CTTTGGAGGTTCGAGGCGGGTGG + Intergenic
955338438 3:58106397-58106419 TTTGGGAGGGCCGAGGCAGGTGG - Intronic
955338576 3:58107272-58107294 TTTGGGAGGGCCGAGGCGGGTGG - Intronic
956433671 3:69212114-69212136 TTTGGGAGGCCCGAGGCAGGTGG + Intronic
956441564 3:69285598-69285620 TTTGGGAGGCTCGAGGCAGGTGG + Intronic
956831567 3:73054159-73054181 TTTTGGGGGACCGAGGCGGGTGG - Intronic
958923705 3:100134723-100134745 TTTTGGAGGAGGGAGGCTGCCGG + Intronic
958980152 3:100710084-100710106 TTTGGGAGGTTTGGGGCGGCCGG + Intronic
961183117 3:124891678-124891700 TTTGGGATGACCGAGGCAGGAGG + Intronic
961581307 3:127885253-127885275 TTTGGGAGGCTCGAGGTAGGAGG - Intergenic
961706826 3:128793394-128793416 TTTGGGAGGCCCGAGGTGGGTGG - Intronic
963270750 3:143283579-143283601 TTTGGGAGGACCAAGGGGACAGG - Intronic
965355619 3:167669492-167669514 TTTGGGAGGATGGAGGGAGGAGG + Intergenic
967316694 3:188156589-188156611 TTTGGGAGGCTCGAGGCAGGTGG + Intronic
967529122 3:190529293-190529315 TTTGGGAGGGCCGAGGCAGGTGG + Intronic
969454414 4:7293059-7293081 TTTGGGAGGCCCGAGGCGGGCGG + Intronic
972357276 4:38291847-38291869 TTTAAGAGGATCGAGGTGGGCGG - Intergenic
972632625 4:40855489-40855511 TTTGGGAGAACCGAGGCAGGTGG + Intronic
974441936 4:61929930-61929952 TTTGGGAGGTCCGAGGCAGGCGG + Intronic
975114426 4:70663437-70663459 TTTGGGAGGCTCGAGGCAGGTGG - Intronic
977533692 4:98230910-98230932 TTTGGGAGGCCCGAGGTGGGTGG - Intergenic
978125908 4:105135039-105135061 TTTGGGAGGCTGAAGGGGGCTGG + Intergenic
978581641 4:110237497-110237519 TTTGGAAGGAGCAAGGCAGCTGG + Intergenic
982238706 4:153277160-153277182 TTTGGCAGGTTCTAGGAGGCTGG - Intronic
982777515 4:159457252-159457274 TTTGGGAGGGCTGAGGCGGGCGG + Intergenic
983550691 4:169014427-169014449 TTTTGGGAGATGGAGGCGGCAGG + Intergenic
983638633 4:169924060-169924082 TTTGGGAGGCCAGAGGCGGGTGG - Intergenic
987083817 5:14450148-14450170 TTTGGTGAGATCGACGCGGCCGG + Intronic
987793276 5:22595832-22595854 TTTGGGAGGCCAGAGGCGGGTGG + Intronic
989523059 5:42423689-42423711 TTGGGGAGGAGAGAGGGGGCGGG - Intergenic
991051668 5:62279237-62279259 TTTGGGGGCACCGAGGCGGGCGG + Intergenic
991372671 5:65935967-65935989 TTTGGGAGGTTCGAGGTGGAAGG - Intronic
992733310 5:79693583-79693605 TTTGGGAGGCTGGAGGCAGATGG - Intronic
993395178 5:87377578-87377600 TTTGGGAGGCTTGAGGCAGGCGG - Intronic
994621986 5:102174628-102174650 TTTGGGAAGATGGAGGGGGCGGG + Intergenic
995091548 5:108184175-108184197 CTTTGGGAGATCGAGGCGGCGGG + Intronic
995192270 5:109330412-109330434 TTTGGGAGGCTTGAGGCAGGTGG + Intergenic
997118439 5:131150479-131150501 TTTGGGAGGGCCGAGGCGGGCGG - Intergenic
998577582 5:143333351-143333373 ATTGGGAGGAAAGAGGAGGCTGG + Intronic
999398366 5:151245396-151245418 TTTGGGAGGCTGGAGACGGGCGG + Intronic
999514365 5:152286072-152286094 TTTGTGATGATCAAGGCAGCTGG + Intergenic
1000081349 5:157850373-157850395 TTTGGGAGGCTTGAGGCGGGCGG + Intronic
1001497545 5:172200160-172200182 TTTGGGAGGCTCGAGGTGGGTGG - Intronic
1003531546 6:6941268-6941290 TTTGGGAGGCTGAAGGCGGGTGG + Intergenic
1003860861 6:10320483-10320505 TTGGGGAGGATGGCGGAGGCTGG - Intergenic
1003883434 6:10498961-10498983 TTTGGGGGGTTCGAGGCAGGCGG - Intronic
1004647841 6:17580377-17580399 TTTGGGAGGCGGGAGGCGGGCGG - Intergenic
1005515844 6:26553410-26553432 TATGGGAGGACGGAGACGGCGGG + Intergenic
1005592365 6:27341971-27341993 TTTGGGGGGGCCGAGGCGGGCGG - Intergenic
1006371709 6:33648698-33648720 CTTGGGAGGCTTGAGGCGGGAGG - Intronic
1006477457 6:34266555-34266577 TTTTGGAAGACCAAGGCGGCTGG + Intergenic
1007230647 6:40345492-40345514 TTGGGGAGGACAGAGGAGGCTGG + Intergenic
1007737286 6:43989745-43989767 TTTGGGAGGCAGGAGGCAGCAGG + Intergenic
1007770464 6:44187796-44187818 TTTGGGAGGCTCGGGGGGGTGGG - Intergenic
1008357384 6:50570601-50570623 TTTGGGAGGGTGGAGGTGGGTGG + Intergenic
1008842566 6:55921425-55921447 TTTGGGAGGCCAGAGGCGGGCGG + Intergenic
1011298367 6:85847800-85847822 TGTGGGAGGATCCAGGTGGGAGG - Intergenic
1011471529 6:87712715-87712737 TTTGGGAGGCTCAAGGTGGGCGG + Intergenic
1011557707 6:88587292-88587314 CTTGGGAGGATGGAGGGGGCGGG - Intergenic
1011690052 6:89858879-89858901 TTTGGGAGGCTTGAGGCAGGCGG - Intronic
1013559828 6:111292969-111292991 TTTGGGAGGCCCGAGGCAGGTGG + Intergenic
1014191533 6:118501785-118501807 GTGGGGAGGATGGAGGCTGCTGG + Intronic
1015553555 6:134437484-134437506 TTTGGGAAGAAGGAGGCGGCTGG + Intergenic
1015780249 6:136858057-136858079 TTTGGGAGGCTGAAGGCGGGAGG - Intronic
1015794237 6:136994633-136994655 TTTGGGAGGCCTGAGGCGGGAGG - Intergenic
1016806754 6:148219545-148219567 TTTGGGAGGATAAAGGTGACAGG - Intergenic
1021706910 7:23376621-23376643 TTTGGGAGGCCCGAGGCAGGCGG + Intronic
1021826422 7:24557076-24557098 ATTTGGAAGATGGAGGCGGCTGG + Intergenic
1021997465 7:26194151-26194173 TTTGGGAAGGCCGAGGCGGACGG + Intronic
1022040004 7:26572050-26572072 TTTGGGAGGCTGGAGGCGGGTGG + Intergenic
1023406725 7:39841691-39841713 TTTGGGAGGGCCGAGGCAGGCGG - Intergenic
1024767317 7:52674893-52674915 CTTGGGAGGGTTGAGGCGGGAGG + Intergenic
1025077082 7:55952489-55952511 TTTGGGAGGCTTGAGGCGGGCGG + Intronic
1025753784 7:64314814-64314836 TTTAGGAGGCCCGAGGCGGGCGG - Intronic
1026054664 7:66973912-66973934 TTTGGGAGGCTGAAGGGGGCAGG + Intergenic
1026132716 7:67633750-67633772 TTTGGGAGGCTTGAGGCAGGAGG - Intergenic
1026439484 7:70431625-70431647 TTTGGGAGGCTGAAGGCGGGTGG - Intronic
1026514559 7:71057539-71057561 TTTGGGAGGCTTGAGGCAGAAGG + Intergenic
1026568876 7:71512246-71512268 TTTGGGAGGAGTGAGGCGGGCGG - Intronic
1026963386 7:74424054-74424076 TTTGGGAGGGCCGAGGCAGTTGG + Intergenic
1027387353 7:77671775-77671797 TTTGGGAGGCTGGAGGTGGGAGG - Intergenic
1029242771 7:99176053-99176075 TTTGGGAGGCCCGAGGCAGGCGG + Intronic
1029475584 7:100781881-100781903 TTTGGGAGGCTTGAGGCAGGTGG - Intronic
1032014051 7:128365317-128365339 TTTTGGGGGACCGAGGCGGGAGG + Intergenic
1032499080 7:132386328-132386350 TTTGGCAGGATCCAGACTGCTGG - Intronic
1032589876 7:133182151-133182173 TTTGGGAGGCCCGAGCCGGGCGG + Intergenic
1033304023 7:140211134-140211156 TTTGGGAGGACCGAGGCAGGAGG + Intergenic
1033311364 7:140264401-140264423 TGTGGGAGGAAGGAGGCAGCCGG - Intergenic
1034195743 7:149245748-149245770 TTCGGGAGGCTTGAGGCGGGAGG - Intronic
1034413826 7:150954926-150954948 TTTTGGGGGGTCGAGGAGGCTGG - Intronic
1037492360 8:19408400-19408422 TTTGGGAGGTTAGAGGAGGGGGG - Intronic
1037499793 8:19474623-19474645 TTTGGGAGGCCCGAGGTGGGTGG + Intronic
1038725818 8:30082093-30082115 TTTGGGAGGATGAAGGCGGGTGG + Intronic
1038766472 8:30433090-30433112 TTTGGGGGGAGTGAGGCCGCTGG - Intronic
1039433326 8:37542796-37542818 TTTGGGAGGGCTGAGGCGGGTGG - Intergenic
1039609926 8:38911730-38911752 TTTGGGAGGCTTGAGGCAGGAGG + Intronic
1043741846 8:83824153-83824175 TTTGGGAGGGCCGAGGCAGGTGG + Intergenic
1044048904 8:87474668-87474690 TTTGGGAGGGCCGAGGCAGGCGG - Intronic
1045133253 8:99182317-99182339 TTTGGGAGGATGAAGGAGGAAGG + Intronic
1045646700 8:104306363-104306385 TTTGGGAGGACCAAGGCAGGTGG - Intergenic
1049407095 8:142456674-142456696 TTTGGGAGGAGCGAGACCGAGGG - Intronic
1049409655 8:142466769-142466791 TTTGGGAGGTGGGAGGCTGCAGG + Intronic
1050444190 9:5701366-5701388 TTTGGGAGGCCCAAGGCGGGTGG + Intronic
1051284710 9:15484225-15484247 TTTGGGAGGATCACCGAGGCTGG + Intronic
1053320876 9:37097903-37097925 TTTGGGAGGCTTGAGGCAGGCGG + Intergenic
1055608127 9:77992699-77992721 TTTGGGAGGCTGAAGGCGGGTGG + Intronic
1056644975 9:88403464-88403486 TTTGGGAGGCTTGAGGTGGGAGG + Intronic
1058896297 9:109403594-109403616 TTTTGGAAGACCGAGGCGGGAGG + Intronic
1058970782 9:110080921-110080943 TTTGGGAGGCCCAAGGCGGGTGG - Intronic
1059118774 9:111622621-111622643 TTTGGGAGGGCCAAGGCGGGTGG - Intergenic
1060693890 9:125689502-125689524 TTTGGGAGGCTTAAGGAGGCAGG + Intronic
1060743693 9:126116223-126116245 TTTGGGGGGGTCTAGGCGACAGG - Intergenic
1061715633 9:132517161-132517183 TTTGGGAGGAGGGAGAAGGCTGG - Intronic
1061931895 9:133837451-133837473 TTTGGGAGGCCCGAGGCGGGCGG + Intronic
1062232559 9:135490261-135490283 TTTGGGAGGTCCGAGGCAGGCGG - Intergenic
1062377492 9:136268955-136268977 TCTGGGAGGACCAAGGCAGCTGG + Intergenic
1185526675 X:785622-785644 TTTGGGAGGCCTGAGGCGGGTGG - Intergenic
1185555814 X:1020292-1020314 TTTGGGAGGGCCGAGGCAGGTGG + Intergenic
1187056864 X:15748804-15748826 TTTGGGAGGCTTGAGGTGGGAGG + Intronic
1187901861 X:24033347-24033369 TTTGGGAGGCCCGAGGCGGGTGG - Intergenic
1189011459 X:37049464-37049486 TTTGGGAGGTTCCAGGGGCCCGG + Intergenic
1190142731 X:47862283-47862305 TTTGGGAGGTCCGAGGCAGGCGG + Intronic
1192257368 X:69473554-69473576 TTTGGGAGGCCCGAGGCAGGTGG + Intergenic
1193276643 X:79596506-79596528 TTTTGGAGGGTGGAGGCTGCGGG - Intergenic
1194565291 X:95479376-95479398 TTTGGGAGGCTCGAGCTGGGAGG - Intergenic
1195170006 X:102258226-102258248 TTTGGGAGGCCCGAGGCAGGAGG - Intergenic
1195188851 X:102428874-102428896 TTTGGGAGGCCCGAGGCAGGAGG + Intronic
1195378363 X:104249342-104249364 TTTGGGAGGCTGGAGGCAGGAGG + Intergenic
1196784583 X:119410643-119410665 TTTGGGAGGGCGGAGGCGGGTGG + Intronic
1196897983 X:120356810-120356832 TTTGGGAGGCCTGAGGCGGGCGG + Intergenic
1197550332 X:127885231-127885253 TTTTGGAGGCTTGAGGCGGGTGG + Intergenic
1197686097 X:129441193-129441215 TTTTGGAGGACCAAGGCGGGAGG + Intergenic
1198105994 X:133461923-133461945 TTTGGGAGGTCCGAGGTGGGTGG - Intergenic
1201409975 Y:13689885-13689907 TTTGGGAGGCTTGAGGTGGGTGG - Intergenic