ID: 1117925414

View in Genome Browser
Species Human (GRCh38)
Location 14:60774041-60774063
Sequence CAGGGTCATCAATTTTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117925411_1117925414 18 Left 1117925411 14:60774000-60774022 CCAAGAGACAATCTGGCATAATT 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1117925414 14:60774041-60774063 CAGGGTCATCAATTTTAGATTGG 0: 1
1: 0
2: 0
3: 11
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117925414 Original CRISPR CAGGGTCATCAATTTTAGAT TGG Intronic
907777082 1:57526750-57526772 CAGGGTTATTATTTTTAGTTAGG - Intronic
912921755 1:113875078-113875100 CAGGGTCATTGATTTGATATGGG + Intergenic
919790468 1:201287169-201287191 GAGGCTTAGCAATTTTAGATGGG - Intronic
920268292 1:204743371-204743393 CACGGTCATAAAATTTGGATTGG + Intergenic
921102191 1:211938547-211938569 CAAGGTCATAAAGTTAAGATTGG + Intergenic
922054876 1:222032188-222032210 CAGTGTGGTCAATTTCAGATGGG - Intergenic
923835829 1:237609713-237609735 CAAGGGCAGCAATTTTAAATGGG - Intronic
924093857 1:240530476-240530498 CAGAGTCATATATTTTAGAGAGG - Intronic
1064715882 10:18176243-18176265 CAGTGTCTTCTATTTTATATTGG - Intronic
1067904683 10:50278432-50278454 CAGGGACAGCAATTTTAAAGAGG + Intergenic
1070392073 10:75979910-75979932 CTGGGTCATTTATTTTAGAATGG + Intronic
1071917677 10:90313899-90313921 CAGGATTATCATTTTTAGAATGG + Intergenic
1072138790 10:92572636-92572658 CTGGGTCTTGAATTTTAGTTGGG - Intronic
1072228882 10:93396157-93396179 CAGAGGCAGCAATTTTAGAGAGG + Exonic
1074708227 10:116155066-116155088 CAGTGTCATTATTTTTAAATGGG - Intronic
1075615353 10:123886890-123886912 CAGGGTCATCAATTTGAAGATGG + Intronic
1078055577 11:8006451-8006473 GATGGTCATCAATTTTATAATGG + Intergenic
1085338065 11:75712546-75712568 CAGGGACATGAAGTTTATATTGG - Intergenic
1085903327 11:80728789-80728811 CAGGGTCTTCAATTGTAAAATGG + Intergenic
1086372220 11:86166425-86166447 CATGCTCATCAATGATAGATTGG + Intergenic
1087931569 11:103984161-103984183 TATGGTCATCAATGTTAGATTGG + Intronic
1088808014 11:113369463-113369485 CAGGATCTTCAAGTTTTGATAGG - Intronic
1089902516 11:122002323-122002345 CAATGTCATCTATTTTATATGGG - Intergenic
1091009578 11:131986582-131986604 AAGGGGCTGCAATTTTAGATAGG - Intronic
1091829825 12:3541688-3541710 CAGGGTCATCATTTCCACATAGG - Intronic
1101509686 12:105381432-105381454 AAGGGGCGTGAATTTTAGATGGG - Intronic
1105328649 13:19393941-19393963 CAGGATCATCAATGTGAGCTGGG - Intergenic
1105863242 13:24435593-24435615 CAGGATCATCAATGTGAGCTGGG + Intronic
1111581092 13:90224696-90224718 CAGGTTTATTAATTATAGATGGG - Intergenic
1117925414 14:60774041-60774063 CAGGGTCATCAATTTTAGATTGG + Intronic
1119867367 14:77985141-77985163 GTGGGTCACCAATTATAGATAGG + Intergenic
1123896897 15:24838736-24838758 CAGGCACATCAAGTTTATATAGG - Intronic
1128615738 15:69107709-69107731 CAGGGCAATCAACTTTAAATTGG + Intergenic
1129028561 15:72602581-72602603 CAGGCTCCTGAATTTTATATGGG + Exonic
1129055610 15:72817846-72817868 CAGGGTTATTACTTATAGATAGG + Intergenic
1130677923 15:85970202-85970224 AATGCCCATCAATTTTAGATTGG - Intergenic
1131787504 15:95928787-95928809 CATGGTCATCAACTTTTGAAGGG + Intergenic
1136091274 16:27921793-27921815 CAGGGTCCTCAACTTGAGAAGGG - Intronic
1141268383 16:82517558-82517580 CAGTGTCTTCACTTTTAGAATGG - Intergenic
1143385321 17:6526102-6526124 GAGGGTCATAAAGTTCAGATGGG - Intronic
1151549768 17:74815405-74815427 CAGGGTATTTAATTTGAGATTGG + Intronic
1154395877 18:13988194-13988216 CACGGTCATCAGTTGTTGATTGG + Intergenic
1159934386 18:74350747-74350769 CAGGGTCATGAAACTTAGCTGGG + Intronic
1167024362 19:46904451-46904473 CAGGGTCATCAGTTTAAGTATGG + Intergenic
928964583 2:36964701-36964723 TAGGGGCAGCTATTTTAGATGGG - Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
931908023 2:66863680-66863702 CAGGGTTATCAATTTTCAGTGGG + Intergenic
933417606 2:82006200-82006222 CAAGATCATCACTTATAGATAGG + Intergenic
936866735 2:117083266-117083288 CAGGTTCATCAATATTACAATGG + Intergenic
937625167 2:124035713-124035735 TTGGGTCATCAATTTTAATTGGG - Intronic
943626859 2:190210891-190210913 CAGGGGGATGAATTGTAGATGGG - Intronic
944027207 2:195184780-195184802 AAGGGTCATCAATTTTAGGAAGG + Intergenic
945810189 2:214540320-214540342 CAGTGTCCTCAATTTTAAAATGG - Intronic
1169297341 20:4411563-4411585 TAGGGTCACCAATGTTCGATGGG + Intergenic
1169683992 20:8249913-8249935 CATGGTCATAAATTTTGAATGGG - Intronic
1175536696 20:59719809-59719831 CAGGGTCATCATTTGTAAAACGG - Intronic
1182931958 22:34182882-34182904 CATGGTCATCAATCTTGGTTAGG - Intergenic
1184532373 22:45064401-45064423 CAGGGTCCTCATTTTTAAAGGGG - Intergenic
949879493 3:8650163-8650185 CAGGGTGTTCAATTTTAAATAGG - Intronic
950140499 3:10611848-10611870 CAGTGTCATAAGTGTTAGATAGG + Intronic
950996355 3:17501597-17501619 CAGGGTAGACAATTTTAGAAGGG - Intronic
955111039 3:55950247-55950269 GAGGGTCATCATTTTCAGAATGG - Intronic
956070495 3:65444937-65444959 ATGGGTCATCGATTTTAAATAGG + Intronic
958658617 3:97036507-97036529 CAGGGTCATCTTTTTAAGCTAGG - Intronic
959685927 3:109146445-109146467 CAGGGTCATGAATTTGGGAGTGG + Intergenic
960260051 3:115557084-115557106 CAGGGGTTTCAATTTGAGATTGG + Intergenic
960416938 3:117396623-117396645 GAGGGGCTGCAATTTTAGATAGG - Intergenic
960873970 3:122278302-122278324 CAGTGTCATCAACTTCAAATTGG - Intronic
962295680 3:134183601-134183623 CAGGTTCATCAATAGTAGCTTGG + Intronic
963023728 3:140898332-140898354 TAGGGTCATTCCTTTTAGATAGG + Intergenic
967641759 3:191873938-191873960 CAAGGTCAGCAAATTTAAATAGG + Intergenic
971893907 4:32564409-32564431 TAGGTTCATTAATTTTATATTGG + Intergenic
972722023 4:41709233-41709255 CAGGATCATGCATTTTAAATAGG + Intergenic
973842976 4:54881181-54881203 AAGGGTCAGCAAATTTAAATGGG + Intergenic
975519210 4:75280608-75280630 AATGGTCATCAATGTTAGACTGG + Intergenic
976519816 4:86013927-86013949 CAGCGTGTTCAATTTTAAATAGG - Intergenic
976661819 4:87547652-87547674 GAGGGTCATCAGTTTTAAATAGG - Intergenic
979046625 4:115873921-115873943 CAGGGTCATGAAGATAAGATTGG - Intergenic
979397340 4:120204126-120204148 CAGGGTGAACAATTTAGGATTGG - Intergenic
979950777 4:126891034-126891056 CAGGGTCATCTTTCTTAGTTGGG - Intergenic
981815083 4:148821439-148821461 CAGGGTTAGCAATTTTGCATGGG + Intergenic
982470300 4:155781426-155781448 CAGGGTCATGAATTGGATATTGG - Intronic
990553204 5:56904675-56904697 TAGGGGTATCAATTTTCGATAGG - Intergenic
995887814 5:116916009-116916031 AAGAGTCATCAACTTCAGATTGG + Intergenic
995924236 5:117350828-117350850 CATGGTCATCAAAATTGGATTGG - Intergenic
996483006 5:123996998-123997020 CAGGGTGAGCAATTTAAGACTGG - Intergenic
998781964 5:145667548-145667570 CAGAGTCATCAATTTGACACAGG + Intronic
1000105976 5:158059085-158059107 CAGGGTTATTACTTTTTGATGGG + Intergenic
1005182371 6:23120356-23120378 AAGGCCCATCAATTATAGATTGG - Intergenic
1006997214 6:38272517-38272539 CAGAGTCATCCATTTAAAATTGG - Intronic
1008478152 6:51955416-51955438 CAGGGTCATAAATTTTTGGGGGG - Intronic
1011849282 6:91605231-91605253 CAGGATCATCAATATCATATAGG + Intergenic
1012519115 6:100098998-100099020 CAGGGTCCTTAATTTCAGGTTGG + Intergenic
1015003480 6:128249238-128249260 CAGGGTTATCAATTTCAATTGGG - Intronic
1015735904 6:136399823-136399845 TATGCTCATCAATTTTAGAAGGG + Intronic
1017378197 6:153796160-153796182 CAAGATCATCAATTCTAGAAGGG - Intergenic
1018069621 6:160152280-160152302 CTGGGTCAAGAATTTTAGATTGG - Intronic
1028170531 7:87590466-87590488 CAGGGTCACCTGGTTTAGATTGG + Intronic
1028216457 7:88139480-88139502 CAGAGTTATCAAATTTAAATAGG - Intronic
1031663893 7:124461112-124461134 AAGGGCCATCAATTGTAGACTGG - Intergenic
1043094164 8:75945609-75945631 CAGAGCCATGAAATTTAGATGGG + Intergenic
1043105214 8:76101032-76101054 CAGGGGCATCTATTTTAGAGTGG - Intergenic
1043178506 8:77052797-77052819 TAGTGTCATAATTTTTAGATGGG + Intergenic
1044524089 8:93231855-93231877 CAGTGTCTTCACTTTTACATTGG - Intergenic
1051047997 9:12898527-12898549 CAGGGTAAAGAATTTTAGATTGG + Intergenic
1052324062 9:27198082-27198104 CAGGCTTCTCAATTTCAGATTGG + Intronic
1052644042 9:31209077-31209099 CAGGGCCATCCATTTTTCATAGG + Intergenic
1055563824 9:77548503-77548525 CAGGGTCAACACTCTTAAATTGG + Intronic
1057750722 9:97790618-97790640 CAAGGTCTTCAATTTTAGCCAGG - Intergenic
1059623388 9:116034230-116034252 AATGGTCATCAATGGTAGATGGG + Intergenic
1060450747 9:123736534-123736556 CATTGTCATCACTTTTAGATAGG - Intronic
1061527971 9:131183621-131183643 CAGGGTAAAGAATTCTAGATTGG + Intronic
1187459529 X:19474333-19474355 CAGGGTCATCCATTTAGGATGGG - Intronic
1187619876 X:21040323-21040345 CATGGTCATAAATTTAAAATGGG - Intergenic
1188459001 X:30401067-30401089 CAGTGTCTTCAATTTTAGGTAGG + Intergenic
1198428768 X:136545599-136545621 CAGGGTCACAAACTTTAGATTGG + Intronic