ID: 1117929476

View in Genome Browser
Species Human (GRCh38)
Location 14:60824950-60824972
Sequence TGGAATTGATCCAATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117929476_1117929483 25 Left 1117929476 14:60824950-60824972 CCCACCCCATTGGATCAATTCCA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1117929483 14:60824998-60825020 TAAAAACATCCTTAAGAGAGTGG 0: 1
1: 0
2: 0
3: 31
4: 297
1117929476_1117929484 26 Left 1117929476 14:60824950-60824972 CCCACCCCATTGGATCAATTCCA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1117929484 14:60824999-60825021 AAAAACATCCTTAAGAGAGTGGG 0: 1
1: 0
2: 3
3: 24
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117929476 Original CRISPR TGGAATTGATCCAATGGGGT GGG (reversed) Intronic
902174040 1:14636048-14636070 TGGAATTGTTTCATTGAGGTTGG - Intronic
902577060 1:17384983-17385005 TGGAACTGATCCAACAGGGGTGG + Intronic
902678231 1:18023924-18023946 TAAAATAGATACAATGGGGTGGG + Intergenic
906551055 1:46666824-46666846 TGGGAATGATCCAGTGGGGAAGG + Intronic
908883697 1:68762668-68762690 TGGAATAGCTTCAATGAGGTTGG - Intergenic
910115108 1:83723547-83723569 TGGAATTCCTCCCCTGGGGTAGG + Intergenic
912210442 1:107551173-107551195 TAGAATTATTCCAATGGGTTTGG + Intergenic
912699109 1:111863084-111863106 TTGAATTGTTACAATGGGCTGGG + Intronic
912812290 1:112803388-112803410 TGGAAGTGACCCTATGGAGTTGG + Intergenic
914385010 1:147160252-147160274 TGGAATTGATCCATTGGATTGGG - Intronic
916509101 1:165455419-165455441 TGGGATTCATCTAATAGGGTGGG - Intergenic
916672545 1:167035979-167036001 TGGGAATGATCCAATTGGGAGGG - Intergenic
917924278 1:179775986-179776008 ATGAATTGATCAGATGGGGTGGG + Intronic
923949903 1:238937980-238938002 TTGAAGGGAGCCAATGGGGTGGG - Intergenic
1063201033 10:3785450-3785472 TCGAATTGAGCCAATGGTGCGGG - Intergenic
1063966078 10:11346968-11346990 TGTAATTGATCCAGTGGTGGGGG + Intergenic
1066741495 10:38522618-38522640 TGGAATGGACTCAATGGGGATGG + Intergenic
1069024665 10:63525933-63525955 TGTATTTAATCCCATGGGGTAGG - Intronic
1069155129 10:65019838-65019860 TGGAATTGTTTCAATAGGATTGG - Intergenic
1070939046 10:80327019-80327041 GGGAGTTGATCGAATGGGGGTGG - Intergenic
1078453853 11:11460005-11460027 TGGACTTGACCCACTGTGGTGGG - Intronic
1078648272 11:13163077-13163099 TAGAATTGATACAATGGAGTGGG - Intergenic
1081034485 11:38125121-38125143 TGGAATTATTCCAATAGAGTGGG - Intergenic
1082092379 11:48100601-48100623 TGAAAATGATCAAATGGGCTGGG + Intronic
1086297873 11:85391377-85391399 TGGAATAGTACCAATGGGATTGG - Intronic
1086844264 11:91729607-91729629 TGGAATGGTTTCAATAGGGTAGG - Intergenic
1088755461 11:112881871-112881893 TGGAATTGATGAATTGGAGTTGG - Intergenic
1090973957 11:131666501-131666523 AGGCATGGCTCCAATGGGGTAGG - Intronic
1098036945 12:66313133-66313155 GGGAATTGATGCATTTGGGTAGG + Intronic
1100231486 12:92612738-92612760 AGGAACTGATCCAAAGAGGTAGG - Intergenic
1101423026 12:104564964-104564986 TGTAATTGAATCAAGGGGGTGGG - Intronic
1101538610 12:105643507-105643529 TGAAACTGAACCTATGGGGTGGG - Intergenic
1102660797 12:114526481-114526503 TGGAAATGACCCAATTGGGAGGG - Intergenic
1104099743 12:125595829-125595851 TGAAATTGCTCCAATGGGGCTGG - Intronic
1105829789 13:24153832-24153854 TGGAATTCATCCCTTGGGGTTGG + Intronic
1113210517 13:107973952-107973974 TGTAATTGTTGCAATTGGGTAGG + Intergenic
1113575763 13:111394310-111394332 TGGGATTTATCCAAGGGGTTGGG + Intergenic
1114523008 14:23350632-23350654 GGCTATTGATCTAATGGGGTGGG + Intronic
1114537628 14:23432944-23432966 TGGAATTGAACCAAGGATGTTGG + Intronic
1117929476 14:60824950-60824972 TGGAATTGATCCAATGGGGTGGG - Intronic
1119539600 14:75429208-75429230 TGGAGATGACCCAAGGGGGTCGG - Intronic
1123945917 15:25238845-25238867 TGGCATTGTTTCAATGCGGTTGG + Intergenic
1131350870 15:91698593-91698615 TTGAATTGAGGCAATGGGGCTGG + Intergenic
1131645784 15:94341593-94341615 TTGAATTGAGGCAGTGGGGTGGG + Intronic
1135050999 16:19192944-19192966 TGCACTTGAGCCAATGGGCTGGG + Intronic
1139184881 16:64794252-64794274 TGGAATTGGTCCAGTTGGGGAGG - Intergenic
1141209776 16:81966904-81966926 TGAAATTGATGCCATGGGGTGGG - Intergenic
1143029356 17:3959354-3959376 TGGAAGTGTTCCAGTGTGGTGGG - Intronic
1144874903 17:18392435-18392457 TGGAATGGATCCACTGTGGGTGG + Intergenic
1145157322 17:20551986-20552008 TGGAATGGATCCACTGTGGGTGG - Intergenic
1148761192 17:50001506-50001528 TGGAACTTCTCCAAAGGGGTTGG + Intergenic
1149290538 17:55213962-55213984 TGGAATGTATCCAAAAGGGTAGG + Intergenic
1149558567 17:57591901-57591923 TGGGATTGAGCCAATGTGCTCGG - Intronic
1149649200 17:58266154-58266176 TGGAATTGATCCTCTGGTGCGGG + Exonic
1150466680 17:65399147-65399169 TGGAATTGATTTAAAGGGGAAGG + Intergenic
1150837674 17:68579182-68579204 TGGAGGTGATCCAATGTGCTGGG + Intronic
1151969702 17:77451324-77451346 GGGAATTGCTCCAAGGGGGCAGG - Intronic
1152247639 17:79193491-79193513 GGGAATAAATCCAATGGGGCTGG - Intronic
1203178171 17_KI270729v1_random:35219-35241 TGGAATTGATCCAAATGGAATGG + Intergenic
1203194207 17_KI270729v1_random:216753-216775 TGGAATGGATCCGATGGGAATGG + Intergenic
1203203569 17_KI270730v1_random:16179-16201 TGGAATGGATCCGATGGGAATGG + Intergenic
1153054074 18:928299-928321 TGGAATTGTTCCAAGGGAGGTGG + Intergenic
1153685619 18:7542003-7542025 AGGAAGTTATCCAATGTGGTAGG - Intergenic
1156638280 18:39057670-39057692 TGGCTTTGATCCAATGGGACTGG - Intergenic
1157949094 18:52014361-52014383 GGGAATTGATCCAGTGGTTTTGG + Intergenic
1159706545 18:71696381-71696403 TGAAAGTGAGCCAATGGGGCTGG - Intergenic
1166081249 19:40445084-40445106 TGGAAGTGACTCAATGGGGCAGG - Intergenic
1166916542 19:46199339-46199361 TGGAACTGATCCTCAGGGGTTGG - Intergenic
925765894 2:7234974-7234996 TGGGAATGATCCAGTAGGGTGGG + Intergenic
931471020 2:62537685-62537707 TGGAATGGAGACAGTGGGGTGGG - Intergenic
931628924 2:64282374-64282396 GGGCATTGAACAAATGGGGTGGG + Intergenic
931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG + Intergenic
935877196 2:107522703-107522725 TTGAATTGATCCTATGCGTTCGG - Intergenic
937056498 2:118941732-118941754 TGGATTTGATCTGATGGGGTGGG + Intergenic
940290039 2:152069259-152069281 GGGAATTGATTCCATGGAGTGGG - Intronic
942426343 2:175864470-175864492 TGGAGTTGGTACAATGGGGCAGG - Intergenic
949038557 2:241833425-241833447 TGGTATTTATCCAAAGGAGTTGG + Intergenic
1169791238 20:9412873-9412895 TGGACTTTATTCAAAGGGGTAGG - Intronic
1169956948 20:11114178-11114200 TGGAAAAGATCCTACGGGGTGGG - Intergenic
1170845005 20:19954765-19954787 TGGTATTTATCCAATGTTGTGGG - Intronic
1171922207 20:31157935-31157957 TGGAATGGAATCAATGGGATTGG + Intergenic
1183226080 22:36550835-36550857 TGGTATTGATCCACTGAAGTTGG + Intergenic
1183296454 22:37032607-37032629 TGGAATTTAACCAATGGGTTTGG + Intergenic
1184454061 22:44599200-44599222 TGGGGTGGATCCAGTGGGGTGGG + Intergenic
952696960 3:36277018-36277040 TGGAATTGATCAAAGATGGTTGG - Intergenic
960503432 3:118464952-118464974 TGGAATTGATCCACTAGTGAAGG + Intergenic
963835691 3:150056007-150056029 TGGAAGGGATCAAAGGGGGTTGG + Intergenic
975075298 4:70199650-70199672 GGGTATTGATTCACTGGGGTAGG - Intronic
975446647 4:74473381-74473403 TGAAGTTGCTCCAAGGGGGTTGG + Intergenic
977735142 4:100405775-100405797 TGGAATTGATTCAGTAGGATTGG + Intronic
979061655 4:116069120-116069142 TGGAATTGTGTCAATGGGATTGG - Intergenic
981738731 4:147980587-147980609 TGGAATTGTTCCAGTAGGATTGG + Intronic
983038076 4:162891976-162891998 GGGTAGTGATCCAATGGGGGTGG - Intergenic
985134330 4:186770163-186770185 TGGCACTGATTCAATGAGGTAGG + Intergenic
986195173 5:5531726-5531748 TGGAAATGACCCAATAGGGAGGG - Intergenic
987058159 5:14215730-14215752 TGCAATTTCTCCAATGGCGTGGG + Intronic
988443744 5:31261427-31261449 TGTAGATCATCCAATGGGGTAGG + Intronic
989160589 5:38387053-38387075 TGGAATTTCTCCAAAGGGGCAGG + Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991680560 5:69135319-69135341 TGCAATTGATACAGTGGGATGGG + Intergenic
992674293 5:79090309-79090331 TGGATTTGAACCCATGGGGCTGG + Intronic
993957551 5:94254328-94254350 TGGAATTGGACCAATGACGTAGG - Intronic
997763659 5:136476433-136476455 TGGAATAGTGCCAATGGGATTGG + Intergenic
997932517 5:138084060-138084082 TGGACCTGGTCCACTGGGGTAGG + Intronic
997956538 5:138283020-138283042 TGGAAATGACCCACTAGGGTAGG + Intergenic
998371500 5:141664883-141664905 TGGTACTGAGCCAATGGGGGTGG - Intronic
998491696 5:142552103-142552125 TGGAATTGCCCCATTTGGGTGGG - Intergenic
1001772879 5:174309070-174309092 TGGATTTGATCCTAGGGGGCAGG - Intergenic
1006366725 6:33620729-33620751 GGGAAATGAAGCAATGGGGTGGG - Exonic
1012160223 6:95874902-95874924 AGGGATTGATCCTATAGGGTGGG + Intergenic
1013553430 6:111232853-111232875 TGGAAATGATCCAATAGAGGGGG - Intergenic
1018127387 6:160694852-160694874 TGGGATTGAAGCAATGGGGGTGG - Intergenic
1018149147 6:160922207-160922229 TGGGATTGAAGCAATGGGGGTGG + Intergenic
1021381599 7:19973780-19973802 TGGTATTCATCCAAAGGAGTTGG - Intergenic
1021791047 7:24205854-24205876 TGGAATTGAAGCCATGGGATGGG + Intergenic
1029337384 7:99914026-99914048 TGCAATTGATCCAAGCTGGTAGG + Intronic
1030990668 7:116295863-116295885 TGGAATAGTTTCAATAGGGTTGG - Intronic
1036384661 8:8268766-8268788 TGGAGTTGGCCCAATGGGGATGG - Intergenic
1037246670 8:16843310-16843332 TGAACTTGGACCAATGGGGTGGG - Intergenic
1042319454 8:67459710-67459732 TGGAATTCATTCTATGGGTTTGG - Intronic
1045250059 8:100475590-100475612 GGAAACTGATCCAGTGGGGTGGG + Intergenic
1048530766 8:135247677-135247699 TGGAATTGTGTCAATAGGGTTGG + Intergenic
1061230943 9:129315520-129315542 TGGAATTTATCCCAGGGGGCTGG - Intergenic
1186219837 X:7338247-7338269 TGGAATTGATCTTAGAGGGTAGG + Intronic
1186512749 X:10142755-10142777 TCGATTTGAATCAATGGGGTGGG + Exonic
1187753393 X:22492852-22492874 TGGAAGTGTTCAAATGGGGATGG + Intergenic
1190961942 X:55260333-55260355 TGGCTTTGACCCAATGTGGTAGG + Intronic
1193857713 X:86625823-86625845 GGTAATTGAATCAATGGGGTGGG - Intronic
1194145180 X:90254041-90254063 GGTAATTGAACCATTGGGGTGGG - Intergenic
1195714380 X:107804322-107804344 TGGAAATGATCCAAAGGAGAGGG + Intergenic
1196872870 X:120129204-120129226 TGGAACTGATCCATTGGAGTTGG + Intergenic
1200490940 Y:3823334-3823356 GGTAATTGAACCATTGGGGTGGG - Intergenic