ID: 1117935190

View in Genome Browser
Species Human (GRCh38)
Location 14:60896237-60896259
Sequence TTCCCACTGCTTGCTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117935190_1117935191 12 Left 1117935190 14:60896237-60896259 CCAGTGGGAGCAAGCAGTGGGAA 0: 1
1: 0
2: 2
3: 11
4: 204
Right 1117935191 14:60896272-60896294 AATTGAAATTCCCTAGATTATGG 0: 1
1: 0
2: 0
3: 16
4: 249
1117935190_1117935192 21 Left 1117935190 14:60896237-60896259 CCAGTGGGAGCAAGCAGTGGGAA 0: 1
1: 0
2: 2
3: 11
4: 204
Right 1117935192 14:60896281-60896303 TCCCTAGATTATGGCCATAGTGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117935190 Original CRISPR TTCCCACTGCTTGCTCCCAC TGG (reversed) Intronic
900414970 1:2530645-2530667 TTCCCACTGCTGGCTGGCAGAGG + Intergenic
904614111 1:31740618-31740640 CACCCACTGCTTGCATCCACGGG + Intronic
906125906 1:43426749-43426771 TGCCGACTGCTTGCTCCTTCGGG - Exonic
906145261 1:43556886-43556908 GCTCCACTGCCTGCTCCCACGGG + Intronic
907688164 1:56634640-56634662 TTCACAGTGCTTGCTCTCAAGGG + Intronic
907716511 1:56931407-56931429 TTCCTCCTGCTGGCTCCCCCGGG - Intronic
907739559 1:57151516-57151538 TTCCATCTGCTTGGTCCCTCTGG - Intronic
908127588 1:61046449-61046471 TTCCATCTTCTTTCTCCCACTGG - Intronic
911557270 1:99360226-99360248 CCCACACTGCTTTCTCCCACAGG + Intergenic
918937431 1:190941057-190941079 TTCCCACTCCTTACTGCCACTGG - Intergenic
919994013 1:202730910-202730932 TTCTCACTGCTGGGTCTCACTGG + Exonic
922896846 1:229107430-229107452 TTCCCTTTGCTTGTTCCCAGTGG - Intergenic
1063200698 10:3783557-3783579 TCCCGTGTGCTTGCTCCCACCGG - Intronic
1064772490 10:18737922-18737944 TTGCCACTGCTGACTCCAACCGG - Intergenic
1065769840 10:29068052-29068074 TGCCCACCACTTGCTCACACAGG + Intergenic
1066332955 10:34444844-34444866 TTCCTTCTGCTTATTCCCACTGG + Intronic
1066471375 10:35701401-35701423 TCCCCACTGCCTGCCCCCTCCGG + Intergenic
1067706120 10:48607554-48607576 TCCCCACTCCATCCTCCCACAGG - Intronic
1067915588 10:50394475-50394497 TTCCAACTGGGTGCTCCAACTGG - Intronic
1068222861 10:54064943-54064965 TGCCTGCTCCTTGCTCCCACCGG + Intronic
1068904678 10:62309756-62309778 TTCCCACAGGTAGCTCCCAGTGG + Intergenic
1069390736 10:67931870-67931892 CTCCCACTGCAGCCTCCCACAGG + Intronic
1076799209 10:132812869-132812891 TGCCCAGGGCCTGCTCCCACTGG + Exonic
1078262579 11:9724190-9724212 TTCATGCTGCTTCCTCCCACTGG - Intronic
1078854466 11:15195710-15195732 TTCCCCCTGCTTTCTACCACTGG - Intronic
1082273071 11:50192992-50193014 TTCCCACGGCCTGCTCCAACAGG - Intergenic
1084575986 11:69988234-69988256 TTCCCACTTTTTCCTGCCACCGG + Intergenic
1084981615 11:72831956-72831978 TGCCCCCTGCCTGCTACCACGGG + Intronic
1085196127 11:74672891-74672913 TTCCCAAGGCCTGTTCCCACTGG - Intergenic
1085522578 11:77147044-77147066 TTCACACCTCTTGCTCCCACAGG + Intronic
1088696578 11:112371170-112371192 TTCACTCTGCTGACTCCCACTGG + Intergenic
1089100986 11:115962238-115962260 TTGCCACTGCATGCCCCCAGGGG + Intergenic
1090084348 11:123638122-123638144 TTCAGAATGCTTGCTCTCACAGG - Intronic
1090404432 11:126468370-126468392 TGCCCACTGCAGGCTCCCAGCGG - Intronic
1093769516 12:23002634-23002656 TCCCCAGTGCTTGCCCTCACTGG - Intergenic
1094155892 12:27336381-27336403 TTCCCACTGGCTCCTGCCACTGG - Intronic
1099034212 12:77565110-77565132 TTCCCACAGCTTCCTCCTTCAGG + Intergenic
1101987433 12:109458565-109458587 TTTCCAGTGCTTCCGCCCACTGG - Intronic
1103242247 12:119423402-119423424 TTTCCATTTCCTGCTCCCACCGG + Intronic
1104073413 12:125368567-125368589 CTTCCACTGCTGCCTCCCACTGG - Intronic
1107313135 13:39101663-39101685 TTCCCACTCCCTGCTCCCTGAGG + Intergenic
1107339907 13:39395021-39395043 TCCCCACTGCTCCTTCCCACGGG + Intronic
1107631679 13:42349514-42349536 TTCCCACTGTTTGATCCTATTGG + Intergenic
1108466599 13:50722316-50722338 TTCCCACTGGTTCCTCCTCCTGG - Intronic
1110184992 13:72663622-72663644 TGGCTACTGCTTGCTGCCACTGG + Intergenic
1110760578 13:79226022-79226044 CTCCCACTGCTTGCTACAGCTGG + Intergenic
1111141891 13:84129606-84129628 TTCCCTCTACTTACTCTCACAGG - Intergenic
1112509529 13:99997489-99997511 TTCGCACTCCTTCCTCCCACCGG + Intergenic
1112592429 13:100776068-100776090 ATCCCACAGGTTGATCCCACAGG + Intergenic
1113604686 13:111596820-111596842 TTTCCATTTCTTGCTTCCACAGG - Intronic
1114633378 14:24173504-24173526 TTACCACAGCTCTCTCCCACAGG + Intronic
1117335877 14:54756905-54756927 TTCCCACTGTCTGCTCTCAAAGG + Intronic
1117935190 14:60896237-60896259 TTCCCACTGCTTGCTCCCACTGG - Intronic
1118848397 14:69565687-69565709 TTCCCAGTGCATTCTCTCACTGG - Intergenic
1119624577 14:76161585-76161607 TTCCCACCCCCTGCTCCCCCTGG + Intronic
1121412821 14:93759778-93759800 TCCCCACTGCTTGCTCTCGCTGG - Intronic
1122118342 14:99538597-99538619 CTCCCCCTGCTGGTTCCCACAGG + Intronic
1126148914 15:45504411-45504433 CTCCTCCTGCTTTCTCCCACTGG + Intronic
1126908197 15:53389814-53389836 TCCCCACTGCTTACTCAAACAGG - Intergenic
1127627414 15:60793918-60793940 TTCCCACTGCTTGCTTAATCCGG - Intronic
1129267172 15:74399979-74400001 TTCCCACTGCTGTCTCCAAGTGG - Intergenic
1129699501 15:77759429-77759451 TGCCCACAGCTTGCTGCCTCAGG - Intronic
1130179698 15:81612740-81612762 GTCCCATTGGCTGCTCCCACTGG + Intergenic
1132994612 16:2816767-2816789 TCCCCACTGCGGGCTCCCGCTGG - Intergenic
1134114699 16:11539156-11539178 TTCCCACTGTCTGCTGCCAGGGG - Intergenic
1134670068 16:16048120-16048142 TTCCCTCTCCTTTGTCCCACAGG + Exonic
1135008885 16:18855369-18855391 TTCCCACTGCATACTCTCCCTGG + Intronic
1135683814 16:24481436-24481458 TTCTCACTGCCTTCTCCCATAGG - Intergenic
1138776483 16:59729689-59729711 GTCCCTCTGCATGATCCCACTGG - Intronic
1138809219 16:60129283-60129305 TTCCCACTGCACCCTCACACTGG + Intergenic
1139073507 16:63414270-63414292 TGCCCCCTGTTAGCTCCCACAGG - Intergenic
1140795706 16:78435496-78435518 TTCCCACAGCTTTCTCACTCAGG - Intronic
1141153198 16:81578936-81578958 TTCCCTCTGCTGTCTCCCACTGG - Intronic
1146133753 17:30300199-30300221 TTGCCCTTGCTTTCTCCCACAGG - Intergenic
1148984755 17:51611850-51611872 TTCCCACAGCTCTCTCCCCCAGG - Intergenic
1149550004 17:57533093-57533115 TTTCCACTCCTTGACCCCACTGG + Intronic
1149661746 17:58337845-58337867 CTCCCACTGCTTTTTCCAACGGG - Intergenic
1151166412 17:72207574-72207596 TTCCTACTTCTTCCTTCCACAGG + Intergenic
1151998428 17:77628413-77628435 TTCCGACTGCATGCTCCTAGAGG + Intergenic
1152859981 17:82690885-82690907 TGCCCACTCCATGCTCCCCCGGG - Intronic
1156373242 18:36489971-36489993 TTCACACTGCTGGCTGCCTCGGG + Intronic
1158717721 18:59895442-59895464 TTCCTACTGATTGCTCTCCCAGG + Intergenic
1158739998 18:60130294-60130316 CTTCCACTGCTTGCTGTCACTGG + Intergenic
1161031493 19:2059820-2059842 TGCCCACTCCCTGCCCCCACTGG - Intergenic
1161569682 19:5023646-5023668 GTCCCACCTCCTGCTCCCACTGG - Intronic
1163428996 19:17255606-17255628 TCCCCTCTCCTTGGTCCCACAGG - Exonic
1164466793 19:28494015-28494037 GTCCCTCTGCTTCCTCCCAGGGG + Intergenic
1164775543 19:30850768-30850790 CTCCCACTGCTTGGACCCAAAGG + Intergenic
1164848722 19:31461188-31461210 TTCCCACAGTTTTCTCCCACTGG + Intergenic
1165828818 19:38720410-38720432 CTCCAACTGCTTTCTCCCAGGGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1166789692 19:45391528-45391550 ATCACTCTGCCTGCTCCCACTGG - Intronic
925192436 2:1895586-1895608 TCCCCACTGCTTGTTCTCATTGG - Intronic
925586351 2:5468351-5468373 TTCCCCCTGCGTGTTCCTACAGG - Intergenic
927266999 2:21162589-21162611 TACTTACTTCTTGCTCCCACTGG + Intergenic
927445868 2:23161124-23161146 TTCACACTGCATGCTATCACTGG - Intergenic
927466490 2:23340579-23340601 TTCCCACTTCTTCCTCCAGCAGG - Intergenic
928189896 2:29154511-29154533 TTCTCACTGCTTGGCCCCAGAGG + Intronic
929336837 2:40758569-40758591 TTCCCATAGCTTGCTCACATTGG + Intergenic
937209262 2:120257787-120257809 ATCCCCCTCCTTCCTCCCACAGG + Intronic
941673873 2:168323621-168323643 TTCCCACTGTTTGTTCTCACAGG + Intergenic
944679717 2:202065762-202065784 TTCCCACTCTTTGCCCACACTGG - Intergenic
945063100 2:205925572-205925594 TTCCCATAGCTGCCTCCCACGGG + Intergenic
946231067 2:218291672-218291694 CTCCCTCTGCTTCCTCCCACTGG + Intronic
948529810 2:238597189-238597211 CTCCCTCTGCTTGCTGGCACTGG + Intergenic
1169491630 20:6076181-6076203 TCCCCACTGGCTGCCCCCACAGG - Exonic
1170785055 20:19460550-19460572 TCCTCTCTGCTTGCTGCCACAGG - Intronic
1172331855 20:34080919-34080941 TTCCTACTGATTGCTGTCACTGG - Intronic
1172663915 20:36586131-36586153 TGCCCTCTGATTCCTCCCACAGG + Intronic
1173384097 20:42572447-42572469 TTCCCCCAGCTTCCACCCACAGG + Intronic
1173564183 20:44027543-44027565 TTCCCACTGGCTGCCCCCATGGG - Intronic
1174960955 20:55156276-55156298 TTCCCAGGGCTTTCTCCCATTGG + Intergenic
1175914255 20:62418465-62418487 GCCCCTCTGCTTGCTCCCCCAGG - Exonic
1176085936 20:63295525-63295547 TTCCCACCGCCGCCTCCCACTGG + Intronic
1176168783 20:63687904-63687926 TCCCCACTGTCTGCTCCCTCTGG + Intronic
1176967105 21:15223749-15223771 TTTCCACTGGTTTATCCCACTGG + Intergenic
1177072173 21:16524215-16524237 TTCCCACAGCTTCCTGCCTCTGG - Intergenic
1178128019 21:29536891-29536913 TCCCCATTACTTGCTCCCATTGG - Intronic
1179682475 21:43033310-43033332 TGCCCACTGCTACCTCACACAGG - Exonic
1180799359 22:18624590-18624612 TGCCCACAGCCTGCCCCCACGGG - Intergenic
1180934899 22:19619023-19619045 TTCCCACTCCTTCCTCCCCGTGG + Intergenic
1181222359 22:21370676-21370698 TGCCCACAGCCTGCCCCCACGGG + Intergenic
1181638119 22:24183662-24183684 TGCCCACAGCCTGCCCCCACGGG + Intronic
1182436714 22:30335538-30335560 TGACCGCTGCTTGATCCCACAGG - Exonic
1183758249 22:39790815-39790837 TTCCCACTGCTTCCCCACAAGGG + Intronic
1185043138 22:48515864-48515886 GGCCCACTGCTGGCTCCCCCAGG + Intronic
950414986 3:12864029-12864051 TCCCCACTCCTGGCTTCCACTGG + Intronic
950575642 3:13830568-13830590 TTCCCAGTGGGTGATCCCACAGG + Intronic
951482360 3:23174762-23174784 TACCTTCTGCCTGCTCCCACAGG - Intergenic
952047051 3:29335349-29335371 ATCTCACTGCTTGCACCAACAGG - Intronic
952582199 3:34847587-34847609 TTCCCTCTGCTTGTTCCTTCAGG - Intergenic
952788082 3:37176013-37176035 TCCCCGCTCCCTGCTCCCACCGG + Intronic
953208534 3:40853632-40853654 TTCCCATTGGTTCTTCCCACTGG + Intergenic
955129246 3:56147610-56147632 CTCCCACTGCTTTCTCACAGAGG + Intronic
956775777 3:72564447-72564469 TTCCCACTACTTGAACCCTCTGG + Intergenic
957593839 3:82234557-82234579 TACCCACTGCCTGATTCCACTGG - Intergenic
961652474 3:128423666-128423688 TCCCCACTTCCTGCTCCCCCAGG - Intergenic
963019802 3:140862027-140862049 TTCCCATTGCTTGCTTTCATCGG - Intergenic
964698135 3:159533287-159533309 TTCCCTCTGTTTTCTCTCACGGG - Intronic
968794552 4:2693954-2693976 TTTCCACTGCATGGTCCCAGGGG - Intronic
969620931 4:8278540-8278562 TTCCCACTGCCTCTTTCCACAGG - Intronic
970465168 4:16315249-16315271 CTCCCATTGCTTCCACCCACTGG + Intergenic
970536479 4:17035408-17035430 TTCATACTGTATGCTCCCACTGG - Intergenic
971349412 4:25843097-25843119 TCCCCACTGCTTCCAGCCACAGG - Intronic
973330214 4:48905214-48905236 ATTCCACTGTTTGCCCCCACAGG - Intronic
977352204 4:95902864-95902886 TTCTGACTGCTTTCTCCCCCTGG + Intergenic
977610248 4:99023004-99023026 TACCCGCTTCTTGCTGCCACAGG + Intronic
982025346 4:151247978-151248000 TTCCTATTGCTTGCTGCCAATGG - Intronic
982531517 4:156550560-156550582 TTCCCACTCTCTGCTTCCACTGG + Intergenic
983374456 4:166907231-166907253 TTCCCACAGCTTGTTGCCAGTGG - Intronic
985035942 4:185839994-185840016 TTTCCACTTCTTTCTTCCACAGG - Intronic
986583335 5:9288370-9288392 TTCCCACCACTGGCTGCCACTGG - Intronic
986583338 5:9288406-9288428 TTCCCTCCCCTTTCTCCCACAGG + Intronic
986860119 5:11917772-11917794 TACCCACTGCTTGAACCCAAAGG + Intergenic
988453849 5:31370284-31370306 TCCCCTCTGTTTTCTCCCACAGG + Intergenic
989506836 5:42236121-42236143 ATCCCATTTCTTCCTCCCACAGG + Intergenic
990257103 5:53982136-53982158 TTCCCACTGCTTGATAACCCCGG + Intronic
992838154 5:80660393-80660415 CTCCCACTGGGTCCTCCCACTGG + Intronic
995590009 5:113689642-113689664 TTCCCTCTGTTTGCTCTCAGTGG + Intergenic
997229575 5:132232734-132232756 TTCCCACTGCATGCCCACCCTGG + Intronic
997260989 5:132465387-132465409 TCCCCACTGCCTGCACACACTGG - Intronic
998184878 5:139970715-139970737 TTCCCACTGCTTCCTACCACAGG - Intronic
999619712 5:153460363-153460385 TTTCCAATCCTTGCTCCCATTGG + Intergenic
1001674727 5:173502465-173502487 TTCCCAGTGATGGCTCCCAGTGG + Intergenic
1001763690 5:174227853-174227875 TTCCCACTCCTTCCTCCGGCAGG - Intronic
1004578447 6:16923180-16923202 TTCCCACTGCTTTCAGCCTCTGG + Intergenic
1006750078 6:36371578-36371600 GGCCCACTGCCTGCTACCACTGG - Intronic
1006869021 6:37233467-37233489 TTGCCACTGCATGCTCACATGGG + Intronic
1007238007 6:40404990-40405012 TTCCCAAGGCTTGGCCCCACTGG + Intronic
1008264467 6:49407401-49407423 TACCCACTGCTAGCTGCCAAAGG - Intergenic
1010373031 6:75133914-75133936 TTCCCTCTGCATGGTCCCAGCGG + Exonic
1012073762 6:94657554-94657576 TTCCCCCTGCTTTCTCAAACAGG + Intergenic
1012532041 6:100249932-100249954 TCCCCACTCCTTTCTCCAACTGG + Intergenic
1013023876 6:106249759-106249781 TTGCCAATGCTTGCTACTACTGG + Intronic
1018004903 6:159612781-159612803 TCACCACTGCTTCTTCCCACAGG + Intergenic
1020613374 7:10428404-10428426 TTCTCACTGCTTTCTCCTTCTGG + Intergenic
1022224176 7:28346123-28346145 TTCCAATTGCTTCCTTCCACAGG - Intronic
1023332750 7:39136481-39136503 TTCCCACTGTTTTCTACCCCAGG - Intronic
1023674569 7:42616496-42616518 TTCCTACTGCTTTGTTCCACTGG - Intergenic
1026122938 7:67553280-67553302 TGCCCAGCGCTTTCTCCCACTGG + Intergenic
1033869301 7:145730696-145730718 TTCCCTCTCCTTGCTCCCCAGGG - Intergenic
1034974371 7:155439376-155439398 TGCCCAGTGATTGCTCCCAGGGG + Intergenic
1035795072 8:2348404-2348426 TTGCCACAGCTTGCTCACCCAGG + Intergenic
1035843665 8:2840105-2840127 TTCCCACTGCAGGCTCTCTCTGG - Intergenic
1036445816 8:8821085-8821107 TTCCCCCTGCCTGTTCCCAGGGG + Intronic
1036810788 8:11866927-11866949 TTCCCACTGCCTGCTGCCGGAGG - Intronic
1037573060 8:20174837-20174859 TTACCATTGCTGGGTCCCACAGG + Intronic
1039916898 8:41866627-41866649 TTCCCATTGCTTTCTCCCACTGG + Intronic
1041635324 8:60136536-60136558 TTCCCACTCTTTTCTACCACTGG + Intergenic
1043531589 8:81157048-81157070 TTCACCCTGCCTTCTCCCACTGG + Intergenic
1044604295 8:94035480-94035502 TCCACACTGCTTCCTCCCAGAGG - Intergenic
1045000067 8:97870753-97870775 TTCTCCCTGCTTGCTCCCAAAGG + Intronic
1045833406 8:106491602-106491624 TAGCCACTGCTTGCTTTCACAGG - Intronic
1047746147 8:127846465-127846487 TTCCTACTGCATGTTCCCTCAGG + Intergenic
1049003333 8:139839659-139839681 TTCCCACTGCTTGTTTCCTAGGG + Intronic
1050658811 9:7860092-7860114 TTCCAACTGGTTGCTATCACAGG + Intronic
1050998069 9:12244704-12244726 TTCCTAGTGCTTGCTCCCTAAGG - Intergenic
1051624341 9:19084351-19084373 TTTACACTGTTTGCCCCCACGGG - Intronic
1051995446 9:23210339-23210361 TGTCCACTACTTCCTCCCACTGG - Intergenic
1057113607 9:92499269-92499291 CTCCAACTTCTTACTCCCACTGG + Intronic
1058694482 9:107547825-107547847 TGCCCACTAACTGCTCCCACAGG - Intergenic
1059017357 9:110533821-110533843 TTCCCAGTGTTTGGTTCCACAGG - Intronic
1059707333 9:116837444-116837466 TTCCCATAGGTTCCTCCCACAGG + Intronic
1061330707 9:129890473-129890495 CTCCGTCTGCTTGTTCCCACAGG - Exonic
1061368490 9:130185055-130185077 AGCCCTCTGCTTCCTCCCACTGG + Intronic
1061893492 9:133634948-133634970 TCCCCACTGATTGCACCCAGAGG - Intergenic
1062117910 9:134818978-134819000 ATCCCCCTGCCTCCTCCCACAGG + Exonic
1203794460 EBV:169259-169281 TTCCCACAGCTTGCCCCCCGGGG - Intergenic
1186988140 X:15038559-15038581 GTCCCACTGCTTGCTATCATTGG + Intergenic
1189243043 X:39540593-39540615 TGCCCACAGCTTGCTCCCTGGGG + Intergenic
1189488110 X:41447940-41447962 TTCCCAACCCTTGCACCCACCGG - Intronic
1189977032 X:46472094-46472116 TTGCCACTGCTGGGGCCCACTGG + Intronic
1195129097 X:101837345-101837367 CCCCCACTGCTCCCTCCCACTGG - Intronic
1195156728 X:102130811-102130833 TCACCACTGCTGGCTCCCAGAGG - Intergenic
1196018811 X:110967527-110967549 TTCCCACTGCTCTCTTCCATGGG - Intronic
1197063449 X:122211169-122211191 TTCCCTCTACTTTCTCCCTCTGG + Intergenic
1201186862 Y:11413273-11413295 TTCCCACTGCTTGTTCATTCCGG + Intergenic
1201620527 Y:15952112-15952134 TTGCCACTGTTTACTCACACAGG - Intergenic