ID: 1117941264

View in Genome Browser
Species Human (GRCh38)
Location 14:60968238-60968260
Sequence GTGGTGAGGCAGCTCTGACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117941264_1117941268 -7 Left 1117941264 14:60968238-60968260 CCATGTCAGAGCTGCCTCACCAC 0: 1
1: 0
2: 0
3: 25
4: 173
Right 1117941268 14:60968254-60968276 TCACCACAGGACCTTGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 131
1117941264_1117941266 -10 Left 1117941264 14:60968238-60968260 CCATGTCAGAGCTGCCTCACCAC 0: 1
1: 0
2: 0
3: 25
4: 173
Right 1117941266 14:60968251-60968273 GCCTCACCACAGGACCTTGCTGG 0: 1
1: 0
2: 3
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117941264 Original CRISPR GTGGTGAGGCAGCTCTGACA TGG (reversed) Exonic
900716833 1:4150465-4150487 GTGTTCGGGCAGCTCTGACCTGG - Intergenic
901482179 1:9532929-9532951 GTGTTGTTCCAGCTCTGACAAGG - Intergenic
902622369 1:17657934-17657956 GAGGTGAGGCTGCCCTGACAAGG + Intronic
902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG + Intergenic
903041871 1:20536798-20536820 CTGGGGGGTCAGCTCTGACACGG - Intergenic
903192234 1:21663244-21663266 GAGGTGTGGGAGCTCTGCCAGGG - Intronic
904897242 1:33826180-33826202 GTTCTGAGTCAGCCCTGACAGGG + Intronic
906718838 1:47990934-47990956 GTGGTGAGGCAGGTCTCTGAAGG - Intronic
907238794 1:53069417-53069439 ATGGTGAGCCAGCACTGGCAGGG - Intronic
908398474 1:63747762-63747784 GTGCTGAGCCAGCTCTGGGATGG - Intergenic
910376253 1:86575173-86575195 GGGCTGAGGCAGTTCAGACAGGG - Intronic
910976327 1:92909998-92910020 GTGGTCAGGCAGCTAAGAGACGG + Intronic
912563045 1:110563962-110563984 GGCATGAGGCAGATCTGACAGGG + Intergenic
912593374 1:110849906-110849928 GCGGAGAGACAGCTCTGACATGG + Intergenic
914397287 1:147282181-147282203 TTGGTGAGTCAGCTTTTACATGG + Intronic
914890695 1:151619992-151620014 GTGGGGAGACAGCTCATACAAGG + Intronic
915938919 1:160106148-160106170 GTGGTGAGGAAGCTGAGGCAGGG - Intergenic
916573938 1:166050794-166050816 GTGCTGAGGTAGCTGTGTCAGGG - Intergenic
916861142 1:168806756-168806778 ATGGTGTGGCAGCTCAGAGAGGG - Intergenic
917418912 1:174841906-174841928 GTGGTTAGGCAGCTGTTATATGG - Intronic
917791331 1:178501063-178501085 GAGGTCAGCCAGCTCTGCCATGG + Intergenic
918004321 1:180527349-180527371 GAGGGGAGGCAGCACTGACCTGG + Intergenic
918099832 1:181363827-181363849 GTGGTGAGAGAGCTCTGGGAAGG + Intergenic
918354572 1:183694844-183694866 TTGCTGGAGCAGCTCTGACAGGG + Intronic
918439719 1:184555086-184555108 CTGGAGTGGCAGCTCTGTCAGGG + Intronic
923913225 1:238472757-238472779 GTGGTGAAGCAGCCCTGCCTTGG - Intergenic
924954011 1:248910065-248910087 GAGGTGAAGCAACTGTGACATGG + Intronic
1064229876 10:13520591-13520613 GAGCTGTGGCAGCTCTGACAAGG + Intronic
1066279904 10:33906440-33906462 GTGGCCAGGCAGCACTGACAAGG - Intergenic
1068818671 10:61347724-61347746 GTCATGTGGCAGCTGTGACATGG - Intergenic
1068963210 10:62886233-62886255 GTGGAGAGACAGTCCTGACAGGG + Intronic
1072634242 10:97167129-97167151 GTGGGGAGGCAGCTCAGTCAGGG - Intronic
1076055379 10:127368161-127368183 GTGGTGATGAAGCTCTGCCAAGG - Intronic
1076316194 10:129543436-129543458 GTGGCGAGGCAGCTCTGTCCTGG - Intronic
1076598913 10:131644534-131644556 GTGGAGAGGCAGCACGGAGAGGG + Intergenic
1077557856 11:3234561-3234583 TTGCTGGGGCAACTCTGACAGGG - Intergenic
1078099908 11:8323850-8323872 GTACTGAGCAAGCTCTGACATGG + Intergenic
1078916292 11:15781831-15781853 GTGCTCATGCAGCTCTGCCAAGG + Intergenic
1080244682 11:30166346-30166368 GTGTTTAGGCAGGTCTAACAAGG + Intergenic
1080833609 11:35919245-35919267 GTGGGCAGGCTGCTCTGCCAGGG - Intergenic
1083272335 11:61578816-61578838 GTGGTAGGGCAGCTGTGACTGGG - Intronic
1085134184 11:74070289-74070311 GTTCTGAAGCAGCTCTGAAATGG - Intronic
1085643420 11:78207650-78207672 GTGGAGAGGCAGCTCTGGTCAGG + Intronic
1085819059 11:79772517-79772539 GGCATGAGGTAGCTCTGACATGG - Intergenic
1088127025 11:106439500-106439522 GTGGTGGGGCATACCTGACAAGG - Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091750296 12:3018019-3018041 GTGAGGAGACAGCTCTGAAAAGG - Intronic
1092032294 12:5297278-5297300 GTGATGGGGCACCTCTCACAAGG - Intergenic
1092787229 12:12038150-12038172 GTGTTGAGCCAGCTCTTTCATGG + Intergenic
1093857969 12:24128561-24128583 GTGGTGAGGCAGATGTGAGAAGG + Intergenic
1094446125 12:30532565-30532587 GTGGTGAAGCAGCTGTGGAAGGG - Intergenic
1096287536 12:50313448-50313470 AGGGTGAGACAACTCTGACAGGG - Intergenic
1098892209 12:76020878-76020900 GTCATGAGTCAGCTCTGACGGGG + Intergenic
1101325540 12:103712356-103712378 TTGGTGAGGCAGCTGCAACAAGG - Exonic
1103662701 12:122534200-122534222 GTGGGGATGCAGCACTGGCATGG - Intronic
1103893933 12:124260942-124260964 GTGGACAGGCAGCTATGACAGGG - Intronic
1103960760 12:124607723-124607745 GTTGTAAGGCAACTCTGCCACGG - Intergenic
1104930607 12:132337485-132337507 GTGGCGAGGCAGCTCTGTGGTGG + Intergenic
1108486711 13:50934367-50934389 ATTGTGAGGCAGCTTTGACAGGG + Intronic
1112162487 13:96883590-96883612 GGAGTGAGGCAGCTGGGACAGGG + Intergenic
1113440306 13:110323294-110323316 GTGGTCAGGGAGCTCTAACCAGG + Intronic
1115091728 14:29585071-29585093 GTGGTGAGGCAGAATTGAAAGGG - Intronic
1115511135 14:34139108-34139130 TTTGAGAGGCAGCTATGACATGG - Intronic
1115696274 14:35902076-35902098 GTGGTGCAGCAGCTCTGATTGGG + Intronic
1117941264 14:60968238-60968260 GTGGTGAGGCAGCTCTGACATGG - Exonic
1121108607 14:91296771-91296793 CTGGTGAGGCAGGTCTGGCAGGG - Intronic
1123989872 15:25675507-25675529 GTGGTGTGGCTGCTGTTACACGG - Intergenic
1125614078 15:40994258-40994280 TTGGTAAGGCATCTCTGATAAGG - Intronic
1125743073 15:41980914-41980936 GTGGGGAGGCAGCGGGGACAGGG + Intergenic
1127164064 15:56225389-56225411 ATGGAGAGGTAGCTCAGACAGGG - Intronic
1128580263 15:68805085-68805107 ATGGTGAGGCAGGACTCACAGGG - Intronic
1128905213 15:71461461-71461483 GTGCTGACCCAGCTCTGAGATGG - Intronic
1129846404 15:78769613-78769635 GAGGGGAGGCTGCTGTGACAAGG + Intronic
1132557931 16:580631-580653 GTGGGGAGGCACCTCTGACCTGG + Intronic
1133166971 16:3954709-3954731 GTGTTGCGGCTGCTCTGAGATGG - Intronic
1133230994 16:4366417-4366439 GTGGGAAGGCAGCTCTCACAGGG - Intronic
1139278505 16:65749904-65749926 GTGGGGAGGGGGCTCTCACAGGG + Intergenic
1139439666 16:66959766-66959788 GTCTGGAGGCAGCTCTGAAAAGG + Intergenic
1140948058 16:79789429-79789451 GTGGTGAGGCAGCACTGAGGAGG - Intergenic
1141541609 16:84727043-84727065 GTGGTGTGGCATGGCTGACAGGG + Intronic
1143019654 17:3910574-3910596 GTGCGGGGGCAGCTCTGGCATGG + Intronic
1144215061 17:13048111-13048133 GAGGTCAGGCAGCTATGACGGGG + Intergenic
1144714877 17:17426943-17426965 GTTTTCAGGCAGCCCTGACAGGG + Intergenic
1147700856 17:42393978-42394000 GAGGTGAAGCAGTTCTCACAGGG - Intergenic
1150146621 17:62774559-62774581 GAGGGGAGGGAGCTCTGAGAAGG + Intronic
1151334512 17:73432036-73432058 GCGGGGGGACAGCTCTGACAAGG + Intronic
1152525661 17:80887020-80887042 GTGGAGGGGCAGCTCTTACCTGG + Intronic
1153623851 18:7004929-7004951 GCCGTGAGGCAGCAGTGACAGGG + Intronic
1157595235 18:48860122-48860144 GTGGAGCGTCAGCTCTGCCATGG - Exonic
1161086808 19:2339239-2339261 GGGGTCGGGCGGCTCTGACACGG + Intronic
1161754387 19:6121018-6121040 GTGGTGGGGCAGCCCCTACATGG - Intronic
1162042124 19:7977343-7977365 GTAGTGAAACAGCTCTGCCAAGG - Intronic
1163729232 19:18940180-18940202 GTGGGGCGGCAGCTCTGGCCTGG + Intronic
1164479780 19:28602514-28602536 GTGGTGAGGCAGTCGTGACAAGG + Intergenic
1165331382 19:35142769-35142791 CAGGTGCTGCAGCTCTGACACGG + Exonic
1168047947 19:53807531-53807553 GGGGTGAAGCTGCTCTGTCAAGG - Exonic
1168702048 19:58446343-58446365 GTGGTGTGATAGCTCTGCCAAGG - Intergenic
1168709728 19:58492080-58492102 CTGGTGAGGGTGCTCTGAAAAGG - Intronic
925194966 2:1915342-1915364 AAGGAGAGTCAGCTCTGACATGG - Intronic
925327586 2:3035475-3035497 GCGGTGACTCAGCTCTGCCATGG + Intergenic
926326115 2:11786066-11786088 GTGGGGTGGCAGCACTGACAAGG + Intronic
927067647 2:19489973-19489995 GTTTGGAGGCAGCACTGACATGG - Intergenic
929267138 2:39930662-39930684 GTGATGAGGCAGCTCTGGAGAGG - Intergenic
929821922 2:45281001-45281023 GTGGTAATGGAGCTCAGACACGG + Intergenic
931738219 2:65217619-65217641 GTGATGATCCAACTCTGACAAGG - Intergenic
933508371 2:83207532-83207554 GAGTTGAGGTAGCTCTGACTTGG - Intergenic
936881651 2:117259448-117259470 GCGGTGAGTCATCTCTGACATGG + Intergenic
944636174 2:201678214-201678236 GTGGTGAGGAGGGTCTGGCAGGG - Intronic
945562153 2:211352277-211352299 TTGTTGAGCCAGCTCTGGCAAGG + Intergenic
947990907 2:234486820-234486842 GTGGAGAGGCTTCTCTCACATGG + Intergenic
948084212 2:235232832-235232854 GTGGAGAGGCAGGTCTGCCGAGG + Intergenic
1172787696 20:37480047-37480069 GTGTTGAAGCAGCTCAGAGATGG - Intergenic
1174367907 20:50067565-50067587 GTGGTGGGGCAGATCCTACAGGG - Intergenic
1175667244 20:60871012-60871034 GTGCTGAGGCAGCTGTGAGCCGG - Intergenic
1176703259 21:10084692-10084714 GTGATAAGGCAATTCTGACATGG - Intergenic
1179473947 21:41631620-41631642 GAGCTGAGGCAGGTCTGGCATGG + Intergenic
1180123180 21:45767721-45767743 GTGGTGAGGCAGCTCTGTGCTGG + Intronic
1182365444 22:29775810-29775832 GTGGGGAGGCAGCTCTCATTTGG - Intergenic
1183109347 22:35637632-35637654 GTGGGATGTCAGCTCTGACAGGG - Intronic
1183629332 22:39023823-39023845 GTGATGAGGCATCTTTGCCAAGG - Intronic
1183740327 22:39665307-39665329 GTGGCCAGGCAGCCCAGACACGG - Intronic
1184769545 22:46589367-46589389 GTGTGGGGGCAGCTCTGATATGG + Intronic
1185334386 22:50265121-50265143 GTGCTGAGGCTGCTGTCACAGGG - Intronic
952849274 3:37714305-37714327 GTGGTGAGGAAGTGCTGAAAAGG - Intronic
953351048 3:42216294-42216316 GTGAGGAGGGAGCCCTGACACGG - Intronic
954290161 3:49645465-49645487 GTGGGGAGGCAGAGCTGGCAGGG - Intronic
954400465 3:50317002-50317024 GTGGTGAGTCATCACGGACATGG + Intergenic
955353187 3:58209229-58209251 AGGGTGAGGCAGCCTTGACAAGG + Intronic
957446136 3:80314665-80314687 GTGGGGAGGCAGCTAAGACCAGG - Intergenic
960080272 3:113533391-113533413 GTGTTGAGGCAGCTAGGGCAGGG - Intronic
962727482 3:138245825-138245847 GTGGTAAGTAAGCTCTGACTTGG + Intronic
964021822 3:152022064-152022086 GGGGTGAGGCCTCTCTGCCAGGG + Intergenic
964451384 3:156816576-156816598 GGGGTGAGGCAGCTCCGCGAAGG + Intergenic
965661529 3:171046867-171046889 CTGCAGAGCCAGCTCTGACAAGG + Intergenic
966834529 3:184038788-184038810 CTGGGGAGGCAGAGCTGACAGGG + Exonic
967849362 3:194070789-194070811 GTGGTGAGAGAGCTCTGAACGGG - Intergenic
967980528 3:195062527-195062549 ATGCGGAGGCAGCTCTGACGCGG + Intergenic
968542072 4:1172808-1172830 GGGGTGCGGCAGCACTGCCAGGG - Intronic
968752984 4:2399875-2399897 GTGCTGAGGAAGCTTTGACGTGG - Intronic
973544010 4:51962071-51962093 GTGGTGGGGCAGGTCACACAGGG + Intergenic
973854118 4:54993685-54993707 GTGGGGAGGCAGCTAAGACCTGG - Intergenic
975476995 4:74834800-74834822 GCTGTGATGCAGATCTGACAAGG + Intergenic
976129318 4:81867858-81867880 GTGTTCAGGCAGCTCTGAAAGGG - Intronic
976571419 4:86616402-86616424 GAAGTGAGGCAGCTCAGACGTGG + Intronic
976736271 4:88313293-88313315 GTGGCGAGGCGGCTCAGGCATGG + Intergenic
980047927 4:128009676-128009698 CTGGTGAGGCTGCTTTGAAATGG + Intronic
980174841 4:129332188-129332210 GGGGTGAGGGAGCTCTCTCAGGG - Intergenic
983182735 4:164667853-164667875 GTGGTGAGGAAGCTCGAACTGGG + Intergenic
983728388 4:170960468-170960490 TAGGTGAAGCAGCTCTGACTTGG + Intergenic
986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG + Intergenic
989178937 5:38556871-38556893 GTGGTGAGGCCGCTCTCAGAAGG + Intronic
992050391 5:72935504-72935526 GTGTTGAGGGAGCTCAGGCATGG - Intergenic
996312837 5:122126265-122126287 GTGGTGGGGCTGCTCCCACAAGG + Intergenic
999282367 5:150374197-150374219 GGGCTGAGGCAGCTCTGACCTGG - Exonic
1001449276 5:171811753-171811775 GTGGTGTGACAGCTGAGACAAGG + Intergenic
1001493702 5:172173319-172173341 GAGGTTCGCCAGCTCTGACAAGG + Intronic
1001929548 5:175663205-175663227 ATGGTGATGCAGCTTTGACTTGG + Intronic
1004088434 6:12474327-12474349 GTGGTGAGGCAGTTCTTTCCAGG + Intergenic
1004867277 6:19866458-19866480 GTAGAGAGGCAGCCTTGACAAGG + Intergenic
1006837969 6:37010683-37010705 GGGGTCTGGCAGCTCTGATAGGG - Intronic
1013976986 6:116090488-116090510 GTGGAGAGGCAGGCCTGAAATGG + Intergenic
1014944069 6:127476082-127476104 GTGCTGCCGCAGCTCCGACAGGG + Exonic
1018977110 6:168574208-168574230 GTGGTGTGGCAGCGCTGGGAGGG + Intronic
1019015743 6:168878557-168878579 CTGGGGAGGCAGCTCTGACCTGG - Intergenic
1019015774 6:168878670-168878692 GTGGGGGGACAGCTCTGACTTGG - Intergenic
1019015812 6:168878788-168878810 CTGGGGAGGAAGCTCTGACCTGG - Intergenic
1019015855 6:168878926-168878948 GTGGGGGGACAGCTCTGACTTGG - Intergenic
1019015868 6:168878965-168878987 ATGGTGGGGCAGTTCTGACCTGG - Intergenic
1028710026 7:93896306-93896328 GTGGTGAGGCAGCACTGAGTTGG - Intronic
1029458043 7:100680786-100680808 GGGGTGAGGCAGCTCAGGCAGGG + Exonic
1029546508 7:101212996-101213018 GGGGTCAGGCACCTCTGATATGG + Intronic
1032407672 7:131668424-131668446 GTGGAGTGGCTGCACTGACATGG - Intergenic
1032517935 7:132520771-132520793 CTGTTGGGGCAGCTGTGACAGGG - Intronic
1033448080 7:141439294-141439316 CTGAGGAGGCAGCTCTGGCATGG - Intronic
1034245709 7:149642894-149642916 CTGGTGCGGTAGCTCTGGCATGG - Intergenic
1036911595 8:12761892-12761914 GTGGTCTGGAAGCTCTAACATGG + Intergenic
1038354094 8:26810579-26810601 CTAGTGAGGCAGCTCTGGCATGG + Intronic
1038562343 8:28591243-28591265 GTGGGGAGCCAGCTTTGATAAGG + Intergenic
1040681934 8:49820977-49820999 TTGGTGAGGCAGCTCTGCACAGG + Intergenic
1040835028 8:51722560-51722582 GTGGTGAGGTGGCTCTCAGAGGG + Intronic
1041729585 8:61051166-61051188 GTGATGAGCCAACTCTGAAATGG + Intergenic
1041790939 8:61695488-61695510 GTGATGGTGCAGCTTTGACATGG - Intronic
1047356591 8:124127974-124127996 GAGGTGAAGCAACTCAGACAAGG - Intergenic
1048602885 8:135937138-135937160 GTGGTGATGCTGCTCTAATATGG - Intergenic
1049259235 8:141629864-141629886 GTGCTCAGCCAGCTCTGTCAGGG - Intergenic
1049313772 8:141947997-141948019 GGGGTGAGCCAGCTCAGGCATGG + Intergenic
1049441609 8:142612275-142612297 TTGCTGAGCCAGCTCTCACATGG - Intronic
1049645328 8:143733503-143733525 GTGGCGGGGCTGCTCGGACAGGG - Intronic
1050584066 9:7091815-7091837 GTGCTGAGGCAGGCCTGACCAGG + Intergenic
1053165803 9:35842734-35842756 GTGGGGAGGTTGCTCTGCCAGGG + Intronic
1057307107 9:93918820-93918842 GTGGTGAAGCAACTCTCCCAAGG - Intergenic
1059962218 9:119576641-119576663 GTGATGAGGAAGCTCAGAGAAGG + Intergenic
1202788289 9_KI270719v1_random:54799-54821 GTGATAAGGCAATTCTGACATGG - Intergenic
1192552673 X:72066594-72066616 GTGGTGAGGCAGAAAGGACAAGG + Intergenic
1194109947 X:89821267-89821289 CTGGTGAGGCAGTTGTGAAAGGG - Intergenic
1196007294 X:110850326-110850348 GAGGTGAGGAAGCTGAGACACGG - Intergenic
1196943596 X:120801830-120801852 GAGGAGAGGCAGCACAGACAGGG + Intergenic
1200146929 X:153931160-153931182 GTTGTGAGGCAGCTCAGTAAGGG - Intronic
1200462612 Y:3476005-3476027 CTGGTGAGGCAGTTGTGAAATGG - Intergenic