ID: 1117942611

View in Genome Browser
Species Human (GRCh38)
Location 14:60984308-60984330
Sequence CACTGGAAGTAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 1, 2: 6, 3: 37, 4: 491}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117942604_1117942611 14 Left 1117942604 14:60984271-60984293 CCTTAATAAGATGAAGGTATGAT 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG 0: 1
1: 1
2: 6
3: 37
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117942611 Original CRISPR CACTGGAAGTAGAGGGAGGA AGG Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900120394 1:1046376-1046398 CTCTGCAAGGAGAGGGAGGTTGG - Exonic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900565677 1:3330853-3330875 GGCTGGAGGCAGAGGGAGGAGGG - Intronic
900688296 1:3963323-3963345 AACTGGATGTAGAGGGTGGTGGG + Intergenic
900708276 1:4094208-4094230 CACTGGAAGTCAAGGGAAGATGG + Intergenic
901496962 1:9627794-9627816 CAAAGGCAGTAGAGAGAGGAGGG + Intergenic
901840445 1:11950758-11950780 CATTGGACGTAGGTGGAGGAGGG - Intronic
901899406 1:12345970-12345992 CACTGGGACTACAGGCAGGAAGG - Intronic
902076908 1:13794276-13794298 CACAGCAAGTAGAGGGATGAGGG - Intronic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
903152953 1:21425901-21425923 CACTGAAATTAGAGTGAGAAAGG + Intergenic
903160179 1:21482080-21482102 CACTGAAATTAGAGTGAGAAAGG - Intronic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905791445 1:40791778-40791800 CACTGGAAATAAATGGAGCATGG + Intronic
905842058 1:41189562-41189584 CACCAGAAGAAGGGGGAGGAAGG + Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906346713 1:45020035-45020057 CCCTGGGGGTAGAGGGAGGTGGG + Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
908292484 1:62682302-62682324 CACTTGAATTAGAGGAGGGAGGG + Intronic
908697487 1:66860061-66860083 CACAGAAAGTAGAGAGATGAAGG + Intronic
908792985 1:67801902-67801924 AAGTGGAAGAAAAGGGAGGAAGG + Intronic
909072131 1:71007511-71007533 CCCTGGAAGCAAAGAGAGGAAGG - Intronic
909547123 1:76860367-76860389 TACTGGAAGTTGAGGAAGTAAGG + Intergenic
909856037 1:80533169-80533191 CTTTGGAGGTATAGGGAGGAGGG - Intergenic
911520187 1:98920215-98920237 CACTGGAAGTATAGGGAAGGTGG + Intronic
912421119 1:109543088-109543110 CACTGGCAGTAGAGGGACCTGGG - Exonic
912493574 1:110076730-110076752 CACTGGAGGAAGAGAGAAGAGGG + Intergenic
913523812 1:119671113-119671135 CACAGGTCCTAGAGGGAGGAGGG + Intronic
914704692 1:150161023-150161045 CACTAGAGGTAAGGGGAGGAGGG + Intronic
914905480 1:151740186-151740208 CACTGGCAGTAGGTGGAGCATGG + Intergenic
915141760 1:153772446-153772468 CACTGGACGCCGAGGGTGGAAGG - Intronic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915873337 1:159585577-159585599 TACTGGAAGTAGGAGCAGGAAGG - Intergenic
916020652 1:160789320-160789342 GGCTGGCAGGAGAGGGAGGAAGG + Intergenic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916616377 1:166445531-166445553 CACTAGAAGAAGAAGAAGGAAGG + Intergenic
916897640 1:169182110-169182132 CTCTGGAAGCTGAGGCAGGAAGG - Intronic
917736809 1:177928985-177929007 CACTGGAGTGAGAGGGAGGAGGG - Intronic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
919598198 1:199590629-199590651 TACTTGAAGTAAAGGGAGTAAGG + Intergenic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
920970046 1:210735272-210735294 TACTGGAAGTAGAAGAAGAAAGG - Intronic
921468864 1:215524696-215524718 TACTAGAAGGGGAGGGAGGAGGG - Intergenic
921650975 1:217677700-217677722 TACTAGAAGTAGAAGGAGGGAGG - Intronic
922244832 1:223785982-223786004 CAGTGGAAGGAAAGGAAGGAGGG + Intronic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
923019743 1:230154207-230154229 CACTGCAAGTGCAGGGTGGACGG - Intronic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923274030 1:232381108-232381130 CAGTGGAAGACGAGGGAGTAGGG + Intergenic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924385300 1:243493873-243493895 AACTGGAAGCAAAGGGAGAAGGG + Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1063030284 10:2227757-2227779 CACTGGCAGTGGTAGGAGGAAGG + Intergenic
1063183108 10:3624067-3624089 CACTATAAATAGAGGAAGGAGGG + Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1063713822 10:8507515-8507537 CACTGGATATATAGGGACGAAGG - Intergenic
1063989557 10:11545231-11545253 CACTGGAGGCTGAGGGAGGGTGG - Intronic
1064525233 10:16249268-16249290 TACTAGAAGGGGAGGGAGGATGG + Intergenic
1066205826 10:33188423-33188445 CACTGGAAATACAGGTATGAAGG - Intronic
1066340949 10:34533266-34533288 CACTACTAGAAGAGGGAGGAAGG + Intronic
1066594443 10:37034562-37034584 GATTTGATGTAGAGGGAGGATGG + Intergenic
1066676445 10:37892794-37892816 CACTGGAAATAGAAAGGGGAAGG - Intergenic
1067467940 10:46515144-46515166 CAATGCCAGTTGAGGGAGGAAGG - Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1071342877 10:84664693-84664715 GACTGGAAGTTCTGGGAGGAGGG + Intergenic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1071930036 10:90458679-90458701 CACAGGAATAAGAGTGAGGACGG - Intergenic
1072145097 10:92628462-92628484 AACTCAAAGTAGAGAGAGGAGGG - Intronic
1072468051 10:95685744-95685766 CACTGGAAGAAGAGAGAGAGAGG - Intronic
1072610670 10:97015343-97015365 CACTGGAAGTAATTGAAGGAAGG + Intronic
1072711299 10:97717316-97717338 CACTGGCAGTAGGGGGAGATGGG + Exonic
1072943119 10:99785267-99785289 CACTCACAGTAGAAGGAGGAGGG + Intronic
1073062696 10:100741949-100741971 CCCGGGAAGTGGAAGGAGGAAGG + Intronic
1073623579 10:105073691-105073713 CACTGGATGTAGAGGTCAGAGGG + Intronic
1074514201 10:114149699-114149721 GAATGGAAGGAAAGGGAGGAAGG + Intronic
1075114882 10:119617940-119617962 CACTGGAAGAAGAGTCAGCAAGG + Intergenic
1075981810 10:126746797-126746819 GACTGGAATCAGAGGGAGGGAGG + Intergenic
1077861434 11:6184424-6184446 CACTGGAGGTGTAGGAAGGAAGG + Intergenic
1078066393 11:8081686-8081708 CCCTCAAAGTTGAGGGAGGAAGG - Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1081588169 11:44401827-44401849 CACCGGAAGTAGTGGTGGGATGG + Intergenic
1082965795 11:58965004-58965026 CAATGGAAGAAGTGGCAGGAAGG - Intronic
1083254934 11:61490109-61490131 CACTGGAAGGAGAGGAGGGGAGG - Intronic
1083896647 11:65623440-65623462 CACTGGAAGGTGAGGCAAGACGG + Intronic
1084320195 11:68369284-68369306 CACTGGAGTTAGAGGGAGCAGGG + Intronic
1085107195 11:73855374-73855396 AACTAGAGGTAGAGGGAGGTGGG - Intronic
1085405861 11:76261785-76261807 ACCTGGAGGTAGAGGGAGGAAGG + Intergenic
1086303235 11:85452576-85452598 CAATGGAAGTAGATATAGGAGGG - Intronic
1086458143 11:86979526-86979548 GAAAGGAAGTAAAGGGAGGAGGG + Intergenic
1086497814 11:87422195-87422217 GAATGGAAGTAGGGGCAGGATGG + Intergenic
1086743671 11:90399703-90399725 CACTGGAAGTGGAGGGGTGGGGG + Intergenic
1087145436 11:94806107-94806129 CACTGACAGTGCAGGGAGGAGGG + Intronic
1087194305 11:95289882-95289904 CACTGGAGGTAGAGGGAGCAGGG - Intergenic
1088308314 11:108433799-108433821 CACTTGCAGTACAGAGAGGAAGG + Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088811485 11:113395564-113395586 CTCTAGAAATAGAGGCAGGAAGG - Intronic
1089015512 11:115162166-115162188 CAGTAGAAGTGGCGGGAGGAGGG + Intergenic
1089023138 11:115239075-115239097 CACTGGAAGTTCAGGGACTAGGG + Intronic
1089177846 11:116561213-116561235 CCCTGGAGGTAGAGGGAGGATGG - Intergenic
1089508518 11:118980626-118980648 CTCTGGAAGTTGACCGAGGAGGG + Exonic
1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG + Intronic
1091767138 12:3128921-3128943 GGCTGGAAGTAGGGGGAGAATGG - Intronic
1091960689 12:4691718-4691740 CCCTGGAAGCAGAGGGTGGTGGG + Exonic
1092561970 12:9625155-9625177 GACTGGTAGTAGAGTGTGGAAGG - Intergenic
1094361598 12:29637186-29637208 CACTGGAGATAGGGGGTGGAGGG + Intronic
1095702023 12:45200550-45200572 GAATGGAAGTTGGGGGAGGAGGG + Intergenic
1095711430 12:45292840-45292862 CACTTAAGGTAGAGGTAGGAGGG + Intronic
1095943652 12:47741405-47741427 CCCAGGGAGAAGAGGGAGGAGGG - Intronic
1096312268 12:50531676-50531698 AAGTGGAAGTAGAGGCAGGCGGG + Intronic
1096607027 12:52774232-52774254 CACTGCATTTAGAGGGAAGAGGG - Intronic
1096885839 12:54718231-54718253 CACTGGAAGTGGAGGCAATATGG + Intergenic
1097268055 12:57756908-57756930 CCCTGGAGGAAGAGTGAGGAGGG - Exonic
1097411703 12:59262411-59262433 TACTGGAAGTTGAGGAGGGAAGG + Intergenic
1097431617 12:59515349-59515371 CACTGAATGTAGAGGAGGGAAGG + Intergenic
1097920146 12:65063313-65063335 CACCTAAAATAGAGGGAGGATGG + Intronic
1098109106 12:67102817-67102839 CATTGGATGTTTAGGGAGGAGGG - Intergenic
1098362718 12:69670577-69670599 TCCTGAAAGTAGAAGGAGGAGGG + Intronic
1099639017 12:85260606-85260628 CGGTGGAGGTAGAGGGAGAAGGG - Intronic
1100129039 12:91467598-91467620 TCCTAGAAGTAGAGGGAGAATGG + Intergenic
1100636094 12:96435988-96436010 AGCTGGAAGTACATGGAGGAAGG + Intergenic
1102347744 12:112170328-112170350 CACTGGAAATTGTGGGAGGTGGG - Exonic
1102720782 12:115014136-115014158 GACTGGGAGTAAAGGGAGGGAGG + Intergenic
1102769755 12:115465159-115465181 AACAGGTAGTAGAGGGAGGTGGG + Intergenic
1103018239 12:117512838-117512860 CACTGGAAGAAAATAGAGGAGGG - Intronic
1104052217 12:125203140-125203162 CACTGGAAGTAAAGCAGGGAAGG - Intronic
1104266655 12:127239772-127239794 CTCTGGAAGAAGAGAAAGGAGGG + Intergenic
1104376979 12:128272185-128272207 GACTGGAGGTAGAGGAAGGAGGG - Intronic
1105050903 12:133049852-133049874 AAGCGGAAGTTGAGGGAGGAAGG - Intronic
1107050965 13:36048941-36048963 GGCTGGAAGTGGAGGGAGGCTGG + Intronic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1108447947 13:50527967-50527989 AACTGGAAGCTGGGGGAGGATGG + Intronic
1108719032 13:53111182-53111204 CCCTGGATGTAAAGGCAGGAGGG + Intergenic
1108791442 13:53973274-53973296 CACTGGAACAGGAGTGAGGATGG + Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112195044 13:97217636-97217658 TACTGGATGTAAAGGTAGGAAGG + Intergenic
1112476074 13:99731723-99731745 CCCTGGATGGGGAGGGAGGAAGG + Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1113153925 13:107295633-107295655 AAATGGAAGGAGTGGGAGGAGGG + Intronic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1114370130 14:22077342-22077364 CACTGGAATCTGAGGGAAGAAGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1117732795 14:58740777-58740799 GACTGGAAGGAGTGGGAGGCAGG + Intergenic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118597688 14:67448780-67448802 GACTGGAAACAGAGGGAGTAGGG + Intronic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119534960 14:75395571-75395593 CCCTGGAAGCAAAGGGAGAAGGG - Intergenic
1120275584 14:82369542-82369564 CACTGCCAGTGGAGGAAGGAGGG - Intergenic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121375813 14:93410092-93410114 CACTGCTAGGTGAGGGAGGAAGG - Intronic
1121441425 14:93952077-93952099 GACTGGCAGCAGGGGGAGGAGGG + Intronic
1122169348 14:99859359-99859381 CGCTGGAAGTGAAGGGAGAAGGG - Intronic
1122295054 14:100700812-100700834 CATAGCAAGTAGAGGGAGGCTGG + Intergenic
1122544164 14:102513083-102513105 CACAGGCAGTAGGGGGAGGCTGG + Intergenic
1123881032 15:24677450-24677472 GACTGGAAGAAGAGTCAGGAAGG - Exonic
1123978117 15:25571927-25571949 GACTGGTATTAGAGGAAGGATGG - Intergenic
1125409901 15:39395254-39395276 CAATGGAAGGAGAAAGAGGAAGG + Intergenic
1126790033 15:52212518-52212540 CACTCGCAGAAGAGGAAGGAAGG + Intronic
1127119227 15:55757035-55757057 CAGAGGAAGAACAGGGAGGAAGG + Intergenic
1128091567 15:64922409-64922431 CACTGGGATTTGAGGGAGCAGGG + Intronic
1128802994 15:70508911-70508933 CACTGGAAGAAGAGAGGGGTGGG - Intergenic
1129313966 15:74729931-74729953 CACTAGAACTAGAGGCAGGCAGG - Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129597130 15:76973928-76973950 CACAGTAAGTAGTGGGAGGATGG + Intergenic
1129648189 15:77457786-77457808 CAAAGGAAGTAGAGGATGGAAGG - Intronic
1129738570 15:77978921-77978943 CACTGGACGTGGCGGAAGGAGGG - Intergenic
1129847502 15:78774689-78774711 CACTGGACGTGGCGGAAGGAGGG + Exonic
1130254404 15:82319220-82319242 CACTGGACGTGGCGGAAGGAGGG - Intergenic
1130600561 15:85270750-85270772 CACTGGACGTGGCGGAAGGAGGG + Intergenic
1130867486 15:87945072-87945094 CACTGGAAGGGGAGGCAGGGAGG + Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131662101 15:94528593-94528615 CACTGGAAGTAAAAAGTGGAAGG - Intergenic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1133303626 16:4797285-4797307 CACTGGAAGTGCCAGGAGGAAGG - Exonic
1134052481 16:11146494-11146516 GAATGGATGTAGAGGGAGGGAGG + Intronic
1134299356 16:12975750-12975772 GACTGGAAAAAGAGGGAAGATGG + Intronic
1134357836 16:13500900-13500922 CTCTGGAAGTTGCAGGAGGATGG + Intergenic
1134869358 16:17637913-17637935 CACTGAAATGAAAGGGAGGAAGG + Intergenic
1136445119 16:30312489-30312511 CACTGGTAGTGGTGGGAGAAGGG - Intergenic
1137715856 16:50597976-50597998 CACTGGCAGTAGAGGGAGGAGGG + Intronic
1137858922 16:51826492-51826514 CCCAGGAAGTAGAGGCTGGAGGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1139015446 16:62684180-62684202 CACTGGAGGGAGACTGAGGAGGG + Intergenic
1139310364 16:66023376-66023398 CACAGGCAGCCGAGGGAGGAAGG + Intergenic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1140083595 16:71774303-71774325 GACTGGCAGTTGGGGGAGGACGG + Intronic
1140230456 16:73113240-73113262 CAGAGGAAGTGAAGGGAGGAAGG + Intergenic
1140734208 16:77883765-77883787 CATCGGATGAAGAGGGAGGAGGG - Intronic
1141186485 16:81791212-81791234 CACTGGATGTGGTGTGAGGAGGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141863046 16:86731013-86731035 CACTGGCTGCAGCGGGAGGATGG + Intergenic
1142358081 16:89613535-89613557 CTCTGAAAGTAGAAAGAGGAGGG - Intronic
1143180794 17:4982806-4982828 CTCTGGAAGAAGCGGAAGGATGG - Exonic
1144010726 17:11146342-11146364 CACAAGGAGTAGAGGAAGGAAGG - Intergenic
1144266080 17:13571099-13571121 AACTGGAATTAAAGGGAGAAAGG + Intronic
1144499156 17:15770285-15770307 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1144740891 17:17581693-17581715 CACAGGAGGGAGAGGGGGGAGGG - Intronic
1145162538 17:20585321-20585343 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1146376149 17:32295893-32295915 CACAGGTAGTATAGGGAGGAAGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147596765 17:41722889-41722911 CACTGGCAGAAGAGGGAGGGAGG + Exonic
1147743321 17:42680802-42680824 AGCTGGAAGCAGAGGTAGGAGGG - Intronic
1147841486 17:43374972-43374994 CCCTGGAAGTGGATGGTGGATGG + Intergenic
1148617403 17:49011579-49011601 CTCTGGAGGTTGAGGCAGGAAGG + Intronic
1150135446 17:62692713-62692735 CACAGGAACCAGAGGTAGGATGG + Exonic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151182912 17:72342717-72342739 GACTGGAAGTAAAGGGGGGTGGG + Intergenic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1152105043 17:78323923-78323945 CACAGGAAGGAGAGAGAAGAGGG - Intergenic
1152535658 17:80949119-80949141 CCCTGGAGCTGGAGGGAGGAAGG + Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153351536 18:4085828-4085850 CATTGGAAGAAGAGGGAGTTAGG - Intronic
1153495737 18:5696944-5696966 GACTGGGAGTAGTGGGGGGATGG - Intergenic
1153587388 18:6637126-6637148 AACTGGCTGCAGAGGGAGGATGG - Intergenic
1154219692 18:12441158-12441180 CACTTGAACTGGAGGGAGGGGGG + Intergenic
1155318331 18:24594094-24594116 CACTTAAAGAAGAGGCAGGAAGG + Intergenic
1155996301 18:32334444-32334466 CACAGGGAGTGGGGGGAGGATGG + Intronic
1156077349 18:33296509-33296531 CATTGGAAGAAGCTGGAGGAAGG + Intronic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156399086 18:36724693-36724715 CACTGCAGGGAGAGGGAGCAGGG - Intronic
1157651204 18:49333528-49333550 GACAGGAAGAACAGGGAGGATGG + Intronic
1158886135 18:61829210-61829232 CACTGTAAGGGGAGGCAGGAAGG + Intronic
1159914716 18:74178382-74178404 ACCAGGAAGCAGAGGGAGGAAGG + Intergenic
1159927388 18:74281462-74281484 GACAGGAGGTGGAGGGAGGAGGG + Intronic
1160105801 18:75974903-75974925 AAATGGAAGTTGGGGGAGGAAGG - Intergenic
1160514340 18:79470205-79470227 CCCTGGAGGTGGAGGCAGGACGG + Intronic
1161344130 19:3759599-3759621 CTCTGGAAGAAGATAGAGGAGGG + Exonic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1161717776 19:5886498-5886520 CACAGCAAGTGGAGGGAGGCTGG + Intronic
1161803619 19:6429830-6429852 CACTGGGAGAGGAGAGAGGAGGG + Exonic
1162182966 19:8883201-8883223 CACCTGAAGGAGAGGGAGGTAGG + Intronic
1162732638 19:12728184-12728206 CTCAGCAAGTAGAGGGTGGAAGG - Intergenic
1163357751 19:16825381-16825403 CAGTGGAAGTAGAGAGCGGTGGG - Intergenic
1163415063 19:17181317-17181339 CACGGGGAGGAGACGGAGGATGG - Intronic
1163449022 19:17364742-17364764 GACTGGAATTAGAGGTAGGGTGG - Intronic
1163453990 19:17395234-17395256 AACAGGAAGAGGAGGGAGGAGGG - Intergenic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1163895154 19:20052125-20052147 CACTGGAAGAAGCGGCAGAACGG + Intergenic
1164924868 19:32122722-32122744 CACTGGAAGCAGAGTGAGCCTGG - Intergenic
1165040189 19:33063596-33063618 CTCAGGACCTAGAGGGAGGAAGG + Intronic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165211532 19:34239943-34239965 TAGTGAAAGTACAGGGAGGATGG - Intergenic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1166217001 19:41342298-41342320 CCCTGGAGGAAGAGGAAGGAAGG + Intronic
1166326857 19:42056394-42056416 CACAGGAAGCAGGGGGAAGAGGG + Intronic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166695504 19:44849252-44849274 CACTGGAATGGGACGGAGGAGGG + Intronic
1167555732 19:50194220-50194242 AACTGGATGTAGAGGTAAGAAGG + Intronic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
925130023 2:1488245-1488267 CGCTTCTAGTAGAGGGAGGAGGG + Intronic
925655191 2:6139335-6139357 CACAGGAAGTAGAAGAAGAATGG - Intergenic
925661519 2:6208316-6208338 CCCTGGGAGTAGAGGGAGGGAGG + Intergenic
925957567 2:8982610-8982632 CACTGGAAGTAGATGGATGGAGG - Intronic
926452626 2:13024126-13024148 CAATGGAAAGAGAGGGAGGGAGG + Intergenic
926639068 2:15215817-15215839 AACTAGTGGTAGAGGGAGGATGG + Intronic
927437772 2:23084890-23084912 AACTGGAAGTTGAGTGAAGAGGG + Intergenic
927439897 2:23106701-23106723 TACTGCAAATAGAGGGAGTATGG + Intergenic
929284277 2:40117809-40117831 CACTGGAAGTTTACGGAGGAAGG - Intronic
929503641 2:42511072-42511094 CACTGAACATAGTGGGAGGAGGG - Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
930774540 2:55159273-55159295 CAGTGGAAGTGGAGGGGGCAAGG - Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
932782496 2:74569674-74569696 CAATAGAAGTAGAGTGAGGGAGG - Intronic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
934884409 2:98012008-98012030 CACTGCTAATGGAGGGAGGAAGG + Intergenic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
935580931 2:104755357-104755379 GGCTAGAAGTAGAGGGAGGAGGG + Intergenic
935713491 2:105919432-105919454 AGCTGTAAGTAGAGGGAGGATGG + Intergenic
935778859 2:106494522-106494544 AAATGGAAGGAGAGGGAGTAAGG - Intergenic
936060619 2:109293476-109293498 CACTGGCAGTGGAGAGAGAAGGG - Intronic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
938056708 2:128220996-128221018 AACTGGAAGTAGAGGTGGGTGGG + Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
941158488 2:162007977-162007999 CGATGGAAGATGAGGGAGGAGGG - Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
942266633 2:174234046-174234068 AAGTGGAAGGAGAGGAAGGAGGG - Intronic
942300711 2:174558817-174558839 GCCTGGAGGTACAGGGAGGATGG + Intergenic
943817829 2:192278357-192278379 CACAGGAAGTACAGGAAGCATGG + Intergenic
945020668 2:205567816-205567838 CATTGGAAGCGGAGTGAGGAAGG + Intronic
945715237 2:213350336-213350358 CACTGCAACTTGAGGGTGGAGGG - Intronic
946170371 2:217891796-217891818 CACTGAGAGAAGAGGAAGGATGG - Intronic
946275396 2:218627935-218627957 CTCTGGATGGAGTGGGAGGAAGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946658643 2:221976324-221976346 CAATGGAAGTAGTGGGAAGTGGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
948000124 2:234560739-234560761 CACTGGTGGGAGAGAGAGGAAGG + Intergenic
948262243 2:236613018-236613040 CACATGGAGCAGAGGGAGGAGGG - Intergenic
948363951 2:237442591-237442613 CTCTGTAGGGAGAGGGAGGAAGG + Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169827863 20:9789779-9789801 CACTGGAGGTTAAGGGAGAAGGG - Intronic
1170323404 20:15127896-15127918 TAATGTAAGTAGAGGGAGGTTGG - Intronic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171390091 20:24795657-24795679 GACTGGAAAGAGAGGGAGGTTGG + Intergenic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1172780659 20:37435148-37435170 CATGGGAAGTAGAGCGAGGTGGG - Intergenic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1172998482 20:39088743-39088765 CACTGGAATTAGGGGCAGAAAGG - Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1173793765 20:45844419-45844441 CCCTGAAAGTAAAGGGAAGAGGG + Exonic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1174113185 20:48210302-48210324 CACTGCACGTGGAGGGAGGCGGG + Intergenic
1174359358 20:50018130-50018152 GACAGGAAGGAGAGTGAGGAAGG - Intergenic
1175288862 20:57859921-57859943 GACTGGAAAGAGAGGAAGGAGGG - Intergenic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1175926470 20:62473962-62473984 CACTGGCAGGGGAGGGATGAAGG + Intronic
1177181974 21:17753940-17753962 TAATGGTAGTAGATGGAGGAAGG - Intergenic
1177862479 21:26470619-26470641 CACTGGATGTACAGGAAGCATGG - Intronic
1178499043 21:33110601-33110623 TACTGCAGGGAGAGGGAGGAGGG - Intergenic
1178759941 21:35392643-35392665 CACTGGATGAAGAGTGAAGAGGG + Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180753009 22:18138179-18138201 CACTGGACGCTGAGGTAGGAGGG - Intronic
1181093089 22:20487614-20487636 CAATGGAAGTGGAGGGATGCAGG + Intronic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181805226 22:25370544-25370566 CCCTGGAGTTAGAGGGAGCAGGG - Intronic
1182349776 22:29692721-29692743 CACTGGAAGGAGAGGGGCCAGGG + Intronic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
1184247990 22:43245324-43245346 CAGTGGAGGTAGAGGCAGGCGGG - Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1185104028 22:48857346-48857368 CACTGTAGGAAGAGGCAGGAAGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949346529 3:3082125-3082147 TACTGAAAGTAGAGCAAGGAGGG + Intronic
950191545 3:10980174-10980196 AACTGGAAGTAGAGAGAGGAGGG + Intergenic
950528158 3:13536619-13536641 CAGTGGAAGGACAGGAAGGAGGG - Intergenic
954852254 3:53613338-53613360 TACAGGAAGAAGAGGGAAGAGGG - Intronic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
956585894 3:70864313-70864335 CCCTGGAATTTGAGGGAGGTGGG + Intergenic
957273749 3:78063895-78063917 CCCTGAAAATAGAGGCAGGAAGG - Intergenic
959996800 3:112689162-112689184 TCCTGGAAGGAGAGGGAGAAAGG - Intergenic
960533773 3:118794398-118794420 GACTGGAAGAAGAGTGAGGGAGG - Intergenic
962203844 3:133419282-133419304 CACAGGAATTTGGGGGAGGAAGG + Intronic
962301370 3:134246185-134246207 TACTGGAAGGAGTGGGAGGGGGG - Intronic
962559629 3:136592045-136592067 GAATGGAAGGAAAGGGAGGAAGG + Intronic
962979865 3:140478763-140478785 AACTGAAAAAAGAGGGAGGAAGG + Intronic
962994372 3:140611010-140611032 TTCTGGAAGTAGAGGAAGGCAGG - Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964273815 3:154987361-154987383 CACTGCAGGTAGATGGAGGGTGG - Intergenic
965402717 3:168232190-168232212 CACAGGAAGGAAAGGAAGGAAGG - Intergenic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966449797 3:180045236-180045258 CACTTGAAGGAGAAGAAGGAAGG - Intergenic
966497156 3:180593864-180593886 CATTGGAAGTACAGGGGGGTGGG - Intergenic
966623403 3:181990666-181990688 TATTGCAAGTAGTGGGAGGATGG - Intergenic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
971153789 4:24061431-24061453 CAAAGGAAGTAGAAGCAGGATGG - Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
974164137 4:58178557-58178579 CACAGGATGTAGAGGAAGCATGG - Intergenic
975457278 4:74607212-74607234 CAATGGAAGTATAGAGAAGAGGG - Intergenic
975791973 4:77962930-77962952 CTCTGGAAGTAGAGCTAGGCAGG + Intergenic
975855259 4:78617743-78617765 GACAGGAGGTAGAGAGAGGAAGG - Intergenic
976199419 4:82563634-82563656 GACAGGGAGTAGAGAGAGGAGGG - Intergenic
976711253 4:88073604-88073626 GACTGGAAGTTGGGGGAGGAGGG + Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977808571 4:101332899-101332921 CACTGGAAGTATGTGGAGGGAGG + Intronic
977937440 4:102823366-102823388 CAGTGGAAGTGGTGGTAGGAGGG + Intronic
979548980 4:121969143-121969165 CAGTGGAAGAAAAGGAAGGAGGG - Intergenic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
982926182 4:161339622-161339644 GACAGGAAGTAGAGGGAGAAAGG - Intergenic
983653167 4:170053617-170053639 GACTGGAAGAAGAAGGAGGGGGG - Intergenic
984007055 4:174324672-174324694 CCATGGAAGGAGAGTGAGGAGGG - Intronic
984825069 4:183916855-183916877 GATAGGAAGTAGAGGGAAGAGGG - Intronic
984883415 4:184429618-184429640 CTCTGGAAGTAAAGTCAGGAGGG - Intronic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985485461 5:146096-146118 GACTGCAAGTAGGGAGAGGAGGG - Intronic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985828098 5:2207649-2207671 CACGCAAAGTAGAGTGAGGAAGG + Intergenic
986970847 5:13334731-13334753 TACTGGAAGCAGAGGGTGGGAGG - Intergenic
987729660 5:21752732-21752754 TAGAGGAAGTAGAGGAAGGAAGG + Intronic
987729668 5:21752786-21752808 GAAAGGAAGTAGAGGAAGGAAGG + Intronic
989406266 5:41064569-41064591 CACTGGAGGGAGAGGCAGAAAGG + Exonic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990303252 5:54470238-54470260 CATTGGAAAATGAGGGAGGAAGG - Intergenic
991084855 5:62639394-62639416 CACAGGAAGAAGAGGAAGTATGG + Intergenic
991503691 5:67302961-67302983 CACTGGACAGAGAGGGAGAAGGG + Intergenic
992299376 5:75362948-75362970 CACTGGAAGCCGAGAGAAGATGG + Intergenic
993604727 5:89974947-89974969 GATAGAAAGTAGAGGGAGGAAGG - Intergenic
994732661 5:103511767-103511789 CACAGGAAGTAGAGTGATTATGG + Intergenic
994942442 5:106341626-106341648 CACTGGAAGTAGATAAAGAAAGG - Intergenic
996011565 5:118486428-118486450 CCCTGGAACAAAAGGGAGGAGGG - Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998199604 5:140108602-140108624 CCCTGGAAGGAGGGAGAGGAAGG + Intronic
1000024030 5:157343313-157343335 CACAGGAAGTAGAGAGTGGAAGG + Exonic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000537309 5:162494454-162494476 CACTGTAAATGGAGGGAGGGAGG + Intergenic
1001172990 5:169439117-169439139 CACTGGAAGGAGTGGGGAGATGG - Intergenic
1001482551 5:172098493-172098515 CACAGGATGCAGAGGAAGGATGG + Intronic
1002101164 5:176858351-176858373 CACTGGACAAAGAGGAAGGAAGG + Intronic
1002682771 5:180981362-180981384 CACTGCTGGGAGAGGGAGGATGG + Intergenic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003662396 6:8074903-8074925 CACAGGAAGAAGCGGGAAGAGGG + Intronic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1004111124 6:12720141-12720163 TGCTGGAAGTAGAGGTAGAATGG + Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005257320 6:24016818-24016840 CACTCTAAGTAAAGGGAGAAGGG - Intergenic
1005791558 6:29307817-29307839 CACTTGAATTGGAGGGAGGAAGG - Intergenic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1006376957 6:33676994-33677016 CGCTGAAAGCAGAGAGAGGAAGG - Exonic
1006676141 6:35765010-35765032 CACGGGAGGTTGAGGCAGGAGGG + Intergenic
1006899181 6:37489304-37489326 GACTGGCAGTGCAGGGAGGAGGG + Intronic
1007211349 6:40195530-40195552 CATTTGATGTAGTGGGAGGATGG - Intergenic
1007372429 6:41434952-41434974 CACAGGAAGCGGAGGGGGGAGGG - Intergenic
1007734198 6:43970549-43970571 GGCTGGAAGTAGCAGGAGGAGGG - Intergenic
1007944596 6:45814316-45814338 CTCTGGAAGTAGAGCCAAGAAGG + Intergenic
1008300444 6:49831487-49831509 CAGAGGACGTAGATGGAGGAGGG + Intergenic
1008485820 6:52034338-52034360 GACTTGAAGAAGGGGGAGGAGGG + Intronic
1008597781 6:53060548-53060570 CACTAGAAGTAGATGTAGAAAGG - Intronic
1009355510 6:62739882-62739904 CATTGAAAGTAGATGGAGGGAGG + Intergenic
1010357623 6:74952530-74952552 CACTCAAAGTAAAGGGATGAAGG + Intergenic
1010425479 6:75724558-75724580 AACTGGAAGAAGAGAGAAGATGG + Intergenic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1012994090 6:105956477-105956499 CTCTGCAAGTAGTAGGAGGAAGG + Intergenic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1014273727 6:119363621-119363643 CAATGAAACTAGAGGGAGAAAGG + Intergenic
1014465200 6:121748535-121748557 GACTGGTAGTAGAGGAAGGGAGG + Intergenic
1014693574 6:124591491-124591513 CATTGGAAGCAAAGGGAGGGAGG - Intronic
1015635447 6:135269916-135269938 CACTGGTGGTAGGGGGATGAAGG + Intergenic
1019168369 6:170114623-170114645 CATCGCAAGAAGAGGGAGGAAGG - Intergenic
1019488495 7:1300349-1300371 CACTGCAGGTGGAGGGTGGAAGG - Intergenic
1019508346 7:1404786-1404808 GACTGGGAGGAGTGGGAGGAGGG + Intergenic
1022111866 7:27236812-27236834 GACTGGGAGTAGGGGGAGCAAGG + Intergenic
1023165194 7:37336641-37336663 CACTGAAGCTAGAGGAAGGAAGG + Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1025123227 7:56323880-56323902 CACTGGAGTGAGAGGAAGGAAGG - Intergenic
1027747419 7:82094899-82094921 AGCTGGAATTAGAGGGAGGGAGG - Intronic
1028094132 7:86739349-86739371 TACTGGAAGGAGGGGGATGAAGG - Intronic
1028482329 7:91321252-91321274 CACTGGATGTAGATGAAGGCAGG - Intergenic
1030736809 7:113058717-113058739 CACTGCAAGTAGAGTGGGGAGGG + Intergenic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1031556413 7:123182013-123182035 CACTGGAAGTGTAGGGATGCTGG - Intronic
1031594264 7:123630075-123630097 CACTAGAAGTACAGAGAGAATGG + Exonic
1031870332 7:127083829-127083851 CTCTGGAAGGACAGGGATGAAGG - Intronic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1032879239 7:136071504-136071526 GAATGGAAGTTGAGGGAGAATGG + Intergenic
1033395963 7:140973925-140973947 CACTTGATGTAAAGGGAGAAGGG + Intergenic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1033636513 7:143217143-143217165 CACTGGAAGAAGAAAGAAGAGGG - Intergenic
1033651295 7:143345862-143345884 CCCTGAAAGTAGTGGGAAGAGGG + Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034779062 7:153860398-153860420 CACTGGAAGGAGTTGCAGGATGG + Intergenic
1035041299 7:155929651-155929673 CACTGGATGAGGAGGGAGGGAGG + Intergenic
1035325224 7:158061604-158061626 CACTGGCTGTGGACGGAGGAAGG + Intronic
1036116784 8:5967697-5967719 CACTTGAAGGAGAAAGAGGAGGG - Intergenic
1036541516 8:9717467-9717489 CCCTGGAAATTGAGGGAGAAGGG - Intronic
1037418526 8:18677177-18677199 CAGAGGAACTAGAGGAAGGAGGG + Intronic
1038379552 8:27079860-27079882 TACTTGAAGCAGAGAGAGGATGG - Intergenic
1039272767 8:35900849-35900871 CACGGGAAGAAAAGGAAGGATGG - Intergenic
1039436499 8:37563098-37563120 CACTGGAAGTGGAAGGAGTGGGG - Intergenic
1039447716 8:37646084-37646106 TGCTGGAGGGAGAGGGAGGACGG + Intergenic
1039609098 8:38904766-38904788 CACTGGAGTTAGAGGGATGGAGG + Intronic
1039815058 8:41086316-41086338 CATTGGAAGTATAGGAAGAAGGG + Intergenic
1041547464 8:59061840-59061862 CCCTGCCAGGAGAGGGAGGAAGG + Intronic
1041737925 8:61131486-61131508 CACTGAAAGGTGAGGAAGGACGG + Intronic
1041956888 8:63566140-63566162 AACAGGAAGTTGGGGGAGGAGGG - Intergenic
1042139721 8:65665729-65665751 CTCAGGAAGCTGAGGGAGGAGGG - Intronic
1042903953 8:73754541-73754563 CACTGGATGCACAGAGAGGATGG - Intronic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1046993358 8:120486649-120486671 TATTGGAAGCCGAGGGAGGAGGG + Intronic
1047123901 8:121938567-121938589 CACTGGAAGTAGAAGATGAAGGG - Intergenic
1047324628 8:123824604-123824626 AACTGGAGGAAGAGGCAGGATGG - Intergenic
1047919571 8:129620253-129620275 TACTGTAATGAGAGGGAGGATGG - Intergenic
1048223563 8:132564669-132564691 CACATGGAGTAGAGGGTGGAGGG + Intergenic
1048284448 8:133130913-133130935 CACTGGAGGAAGAAAGAGGAGGG + Intronic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1049056377 8:140240483-140240505 CACCCGAAGTTGAGGCAGGAAGG - Intronic
1049492726 8:142913756-142913778 CAATGGAAGCAGAGGGAGCTGGG - Intronic
1050717048 9:8541610-8541632 CACTGGAAGGCCAGGGTGGAAGG - Intronic
1051039229 9:12785728-12785750 CACTGCTAGGAGATGGAGGAGGG + Intronic
1051901294 9:22044689-22044711 CACAGGAAGGAGGGGGAGGGAGG - Intergenic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1058504536 9:105654765-105654787 CACTGGGAGTAGATGGGGTAGGG + Intergenic
1058710906 9:107678269-107678291 CACTTGAACTTGAGGGAGGATGG + Intergenic
1059336821 9:113574375-113574397 CTGTGGAAGTAGAGGCAGCAGGG - Intronic
1059398302 9:114052709-114052731 TGCTCCAAGTAGAGGGAGGATGG - Exonic
1059494946 9:114701748-114701770 CAGTGAAAGTAGTGGGAGGTGGG - Intergenic
1059678180 9:116560462-116560484 AACAAGAAGAAGAGGGAGGAAGG - Intronic
1059807646 9:117820984-117821006 CACTGGAAGCTGAGGGAGCAAGG + Intergenic
1059842210 9:118230275-118230297 CAATGGAAGGAGAGGAAAGAAGG - Intergenic
1059951298 9:119465501-119465523 CACAGGCAGTACAGGGAGCATGG + Intergenic
1060795914 9:126513267-126513289 CCCTGGAAGATGAGTGAGGAAGG + Intergenic
1060989325 9:127839136-127839158 CACTGAAGGTAGAGGAGGGAGGG - Intronic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062343277 9:136103306-136103328 CACTGGAAGAAGGTGGAGGAGGG - Intergenic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1187485111 X:19695727-19695749 CTCTGCAGGTAGAGGAAGGATGG - Exonic
1187753345 X:22492213-22492235 CACTTGAAGGAGTGGAAGGAAGG - Intergenic
1188344466 X:29046633-29046655 AACTGGAGGTAGGGGCAGGATGG - Intronic
1188521866 X:31047019-31047041 CACTGGAGTTAGAGTGAGAAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189280151 X:39815569-39815591 CACAGAAAGTTGGGGGAGGAAGG + Intergenic
1189917412 X:45869931-45869953 CCCTGTAAGTGGGGGGAGGAAGG + Intergenic
1190923139 X:54876348-54876370 CAAAGGAGGTAGAGGGAGAATGG - Intergenic
1192261992 X:69511092-69511114 GACTGTAGGTAGAGGGAGTAAGG - Intronic
1193396496 X:80990173-80990195 CACTGCAAGGGGATGGAGGACGG - Intergenic
1194739360 X:97554292-97554314 CACTGAGAGGAGAGGTAGGAGGG - Intronic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1196113579 X:111973210-111973232 CAGTGGAAATAGATGTAGGAGGG - Intronic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197009368 X:121542291-121542313 CACTGGATATAGAGTGTGGAGGG - Intergenic
1197916968 X:131546186-131546208 AATTGGGGGTAGAGGGAGGAAGG - Intergenic
1198827117 X:140711128-140711150 CACTGGAAGCACAGAGAGGAAGG - Intergenic
1201273295 Y:12276538-12276560 AACTTGAAGAAGAGGGATGAGGG + Intergenic