ID: 1117942874

View in Genome Browser
Species Human (GRCh38)
Location 14:60987739-60987761
Sequence AACCCACAGCTCCCCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117942873_1117942874 13 Left 1117942873 14:60987703-60987725 CCATTCTTTTGGAATACTTCTCA 0: 1
1: 0
2: 2
3: 43
4: 390
Right 1117942874 14:60987739-60987761 AACCCACAGCTCCCCTCCACTGG 0: 1
1: 0
2: 2
3: 33
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117942874 Original CRISPR AACCCACAGCTCCCCTCCAC TGG Intronic
900436061 1:2631898-2631920 CACCCACTGATCCCCACCACAGG + Intronic
900665733 1:3814342-3814364 AACCCCCAGCTCACTCCCACAGG + Exonic
901125099 1:6923648-6923670 CACCCCCAGCTCACCGCCACAGG - Intronic
901755184 1:11437207-11437229 ACCCCACCACTCCCCTCCAATGG + Intergenic
901805853 1:11738103-11738125 AGTCAACAGCTGCCCTCCACAGG - Intronic
901889437 1:12250015-12250037 TTCCCACAGTTCCCCTCCTCAGG + Intronic
905391625 1:37639451-37639473 AATCCACAGCCAGCCTCCACTGG + Intergenic
907762486 1:57375149-57375171 ACCCCACAGAAGCCCTCCACAGG + Intronic
908037857 1:60074992-60075014 CACACTCAGCTCCCCTCCAGGGG + Intergenic
912022269 1:105120093-105120115 ACCCCACCGCTTCCCTCCAGAGG - Intergenic
912122497 1:106489673-106489695 AATTCACAGCTGCCCACCACAGG + Intergenic
913138067 1:115911981-115912003 TACCCAGAGCACCCCTCCTCTGG + Intergenic
914882254 1:151556412-151556434 ACCCCCCAGCTCCTCTCCTCAGG + Intronic
916128745 1:161593275-161593297 CACCCCCAGCTCCCCTGCTCAGG - Intronic
916179235 1:162069859-162069881 GCCCCACCGCTCCCCTCCCCGGG + Exonic
917973786 1:180225880-180225902 AAGCCACATCACCCCACCACAGG + Intergenic
920173199 1:204084227-204084249 AACCCACAGCACCACACCACAGG - Intronic
921100421 1:211924094-211924116 AGCCCACCCCTCACCTCCACAGG + Intergenic
922731329 1:227950043-227950065 ATCACAGAGCTCCCTTCCACTGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924711151 1:246531004-246531026 AAATCAAAGCTCCCCTCCACAGG - Intergenic
1065274215 10:24069035-24069057 ATCCAACTGCTTCCCTCCACAGG + Intronic
1067495413 10:46756813-46756835 AGCCCCCAGCTCCCCTCCCCCGG + Intergenic
1067599240 10:47583575-47583597 AGCCCCCAGCTCCCCTCCCCCGG - Intergenic
1067948901 10:50710160-50710182 AGCCCCCAGCTCCCCTCCCCCGG - Intergenic
1069614825 10:69800437-69800459 AACCCAGAGCTCCTGGCCACGGG + Intergenic
1069878548 10:71577822-71577844 CACCCACAGCTTCCCTCCCCAGG - Intronic
1070092598 10:73303001-73303023 ACCCCACCGCCCCCCACCACCGG + Intronic
1070187113 10:74075204-74075226 AAGGCAGAGCTCCCATCCACGGG - Intronic
1070671108 10:78377726-78377748 AACCCACTGCACCCCTCCAGAGG - Intergenic
1070884219 10:79875152-79875174 AGCCCCCAGCTCCCCTCCCCCGG - Intergenic
1071502291 10:86212472-86212494 AAGGCTCAGCTCCTCTCCACGGG + Intronic
1071650773 10:87391452-87391474 AGCCCCCAGCTCCCCTCCCCCGG - Intergenic
1073447741 10:103591336-103591358 AACCCACACCTCCCCACCCAGGG - Exonic
1073512498 10:104051578-104051600 AACCCCCACCTGCCCTGCACCGG - Intronic
1075329985 10:121566889-121566911 AACCCACACAACCTCTCCACTGG + Intronic
1075358176 10:121802690-121802712 CACCCACTGCTCCCATCCCCAGG + Intronic
1075484788 10:122813319-122813341 AACCCAGGAGTCCCCTCCACTGG + Intergenic
1076366240 10:129922500-129922522 AACCCAGACCTGCCCTCCAGGGG - Intronic
1076839883 10:133040671-133040693 CACCCACAGCCCCCCGCCCCCGG - Intergenic
1078094701 11:8289647-8289669 AAGCCCCAGCCCCCCTCCCCTGG - Intergenic
1079833310 11:25299621-25299643 AACTGACTGCTCCCCACCACGGG + Intergenic
1081629905 11:44681911-44681933 AGCCCTAAGCTCTCCTCCACTGG - Intergenic
1083198762 11:61106743-61106765 GCTCCAAAGCTCCCCTCCACAGG - Intronic
1084308876 11:68304455-68304477 ACCCCACATTTCCCCTCCAATGG - Intergenic
1084706887 11:70820793-70820815 AACTCACAGCTCCCCTCTGCTGG - Intronic
1087503115 11:98984938-98984960 AACCTCCACCTCCCCTCCCCGGG + Intergenic
1089332417 11:117699255-117699277 AGGCCAGAGCTCCCCACCACAGG - Intronic
1094313502 12:29112756-29112778 AACCCACTGCTCCCAGTCACAGG - Intergenic
1095607352 12:44085542-44085564 CACCTTCAGCTCCCCTCTACAGG + Intronic
1096017993 12:48296009-48296031 AACCCAGGGCTCCCCTCCCATGG - Intergenic
1096470120 12:51870292-51870314 CACCCACAGCTTCCCTGCAAAGG + Intergenic
1096750295 12:53754368-53754390 AACCCCCATCTCCCCTACCCAGG - Intergenic
1098570237 12:71980185-71980207 AACCCAGAGCTCCCAGCCTCAGG - Intronic
1103880748 12:124164123-124164145 ACCCCACATTTCCCCTGCACTGG + Intronic
1104091074 12:125518247-125518269 CACGGACAGCTCCCCTGCACTGG - Intronic
1104498492 12:129263103-129263125 AGGCCAGAGCTCCCCTCCAGTGG + Intronic
1104573906 12:129949312-129949334 AACCCACAGCTCCTCTTCACTGG + Intergenic
1104746990 12:131216785-131216807 CCACCACTGCTCCCCTCCACGGG - Intergenic
1104785629 12:131446400-131446422 CCACCACTGCTCCCCTCCACGGG + Intergenic
1104789533 12:131473058-131473080 AGCCCACAGCTGCCCTGCCCAGG - Intergenic
1104944491 12:132409553-132409575 GCCCCACAGCTCCCATCCCCCGG - Intergenic
1105380652 13:19884287-19884309 CAGCCACAGCACCCCGCCACTGG - Intergenic
1107891547 13:44918816-44918838 GAGCCACAGCTCCTCTCCGCCGG - Intergenic
1111679204 13:91423565-91423587 ACCCCACACCCCCCCTCTACTGG - Intronic
1113146193 13:107210419-107210441 CACCGAAAGCTCCCCTCAACAGG - Intronic
1113892652 13:113744416-113744438 CACCTACTGCTCCCCTCCACTGG + Intergenic
1114307490 14:21437168-21437190 AAGCCACCTCTCTCCTCCACTGG - Intronic
1114605824 14:23995363-23995385 TAGCCACTGCTCCCCTCCCCAGG + Intronic
1117942874 14:60987739-60987761 AACCCACAGCTCCCCTCCACTGG + Intronic
1118051732 14:62036675-62036697 AAAGGACAGCTCCCCTGCACAGG - Intronic
1118464683 14:66020404-66020426 AGCCAACAGCTGCCCTCCAGGGG + Intergenic
1119405454 14:74395990-74396012 AACACACAGTTCCCCTGCATGGG + Intergenic
1122325495 14:100878961-100878983 GCCCCACTGCACCCCTCCACAGG - Intergenic
1124106792 15:26745615-26745637 TACCCACACCCCTCCTCCACTGG + Intronic
1124739901 15:32285639-32285661 AACTCTCAGGTCCCCACCACTGG - Intergenic
1125157004 15:36598931-36598953 AGCACACAGCTCCCATCCAAAGG - Intronic
1126066337 15:44828908-44828930 CCCCCAGAGCGCCCCTCCACAGG + Intergenic
1126093545 15:45071958-45071980 CCCCCAGAGCGCCCCTCCACAGG - Intronic
1127053012 15:55104282-55104304 AACCCAGATTTTCCCTCCACAGG - Intergenic
1128739862 15:70076247-70076269 AGACCACAGCCCCTCTCCACGGG + Intronic
1128744330 15:70103061-70103083 AACACCCAGCTCCTCTCCTCTGG + Intergenic
1128744621 15:70104649-70104671 ACCCCAGAACTCCCCTCCACTGG - Intergenic
1131075078 15:89490346-89490368 GACCCACAGCTCTCCCACACTGG - Intronic
1131404525 15:92153689-92153711 AACCCACTGCTCCCATCCCAAGG - Intronic
1132587021 16:710009-710031 AACCCCTGGCTCCCCTCCACCGG - Intronic
1132673626 16:1112813-1112835 GACATACAGCTCCACTCCACCGG + Intergenic
1133732534 16:8589584-8589606 CAGCCACAGCTCCCAGCCACGGG + Intronic
1134227141 16:12399876-12399898 TTCCCACAGCTGCCCTCCGCCGG - Intronic
1135484436 16:22851776-22851798 CACTCCCATCTCCCCTCCACTGG + Intronic
1137462918 16:48681859-48681881 AAGCCACAGCCCCTCTCCTCAGG - Intergenic
1138442288 16:57042330-57042352 CACCCACACCTGCCCTCCCCAGG - Intronic
1138459847 16:57141591-57141613 CAGCCCCACCTCCCCTCCACTGG - Intronic
1138477586 16:57281238-57281260 ATCTCACAGCCCTCCTCCACAGG - Intronic
1139192326 16:64879143-64879165 AACCCAGAGCTCCACTCAGCTGG + Intergenic
1139559218 16:67730998-67731020 TACCCTCTGCTCCCCACCACTGG - Intronic
1140991144 16:80212858-80212880 AGTCCACAACTCCCCTCCTCTGG + Intergenic
1141020068 16:80486758-80486780 AAACCACATCCCCCATCCACAGG + Intergenic
1141027664 16:80563379-80563401 AAACTCAAGCTCCCCTCCACAGG + Intergenic
1141636415 16:85316452-85316474 CACCCACACCTCCCAGCCACTGG + Intergenic
1142178157 16:88654505-88654527 ATCCCACAGCCCACGTCCACAGG - Intronic
1143191545 17:5043711-5043733 ACCTCACAGCCCCCCTCTACTGG + Intronic
1143676369 17:8435987-8436009 AACCGACGTCTCCCCTCCGCCGG - Exonic
1144197262 17:12906461-12906483 GTCCCACAACTCCCCTCCTCAGG + Intronic
1144537065 17:16100925-16100947 ATCCCACTGCTGCCCTCCTCAGG + Intronic
1148670582 17:49407168-49407190 AACCCACAGTTCTCCTCCTCTGG - Intronic
1149582666 17:57762178-57762200 CACCCCCAGCCCCCCTACACCGG + Intergenic
1151834021 17:76571812-76571834 AACTCAAAGCTTCCCTCCTCAGG - Intronic
1153397457 18:4640831-4640853 AAACCACTGCTCCACTTCACAGG - Intergenic
1157311921 18:46559406-46559428 AACCCACAGCCCCCACCCAGGGG + Intronic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160558560 18:79741657-79741679 AACACTCAGCTCTTCTCCACAGG + Intronic
1161061971 19:2219789-2219811 AACCCACAGCCCGCCCTCACCGG - Intronic
1161523088 19:4736714-4736736 GGCCCTCAGCTCCCCTCCAGCGG + Intergenic
1162041807 19:7975289-7975311 CAGCCTCAGCTCCGCTCCACTGG - Intronic
1162144418 19:8605152-8605174 GACCCGCAGCTCCCGTCTACTGG - Exonic
1162791371 19:13064723-13064745 GACCCTCAGCTCCCCTCCCCAGG - Intronic
1163550532 19:17964267-17964289 CATCCCCAGCACCCCTCCACAGG - Intronic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1168236888 19:55069177-55069199 AACAAACAGCTCCCGGCCACCGG + Intronic
925205179 2:2000123-2000145 AACCTACAGCTCCCCTCCCTGGG + Intronic
925978845 2:9160914-9160936 GAGCCACAGCTGCCCTCCACAGG + Intergenic
927466509 2:23340691-23340713 AACCCAGAGATCCCCTCCCCAGG + Intergenic
927505915 2:23614855-23614877 AGCCCACATCTTCCCACCACCGG - Intronic
927918041 2:26949078-26949100 ACCCCAGACCTCCTCTCCACAGG - Exonic
928266627 2:29817498-29817520 AACCTGCGGGTCCCCTCCACTGG - Intronic
931634811 2:64331551-64331573 AACCTACAGCTTACCTCCAGAGG - Intergenic
932108781 2:68973999-68974021 TGCCCACAGCTCCCCTCACCTGG - Intergenic
932824456 2:74926818-74926840 CACCCACACCTACCCTTCACTGG - Intergenic
935652477 2:105393977-105393999 AACGCACAGATCCCCAACACGGG + Intronic
937361792 2:121234857-121234879 AGTCCACAGCTCCCCTCAGCGGG + Intronic
940792108 2:158039891-158039913 AAGGCACAGCACCCCTCCCCTGG - Intronic
941653588 2:168119691-168119713 AACCCATTGCTGCCCTCTACTGG + Intronic
942360773 2:175168752-175168774 AACCCGAAGCTCCCCGCCTCAGG - Intergenic
946055268 2:216895659-216895681 AACCCACAGCATCCATCCAATGG + Intergenic
947448552 2:230183539-230183561 AAGCCACAGCGCCTCCCCACTGG - Intronic
948188792 2:236042730-236042752 GGCCCACACCTCCCCTGCACTGG - Intronic
948872837 2:240812246-240812268 CACCCCCAGCCCCCTTCCACAGG - Intronic
949007584 2:241658411-241658433 CCCACCCAGCTCCCCTCCACAGG + Intronic
1171088805 20:22264841-22264863 AACCCCCAGCACCCCTCCACAGG + Intergenic
1172758896 20:37308197-37308219 AACCCTCCCCTCCCCTCCACTGG - Intronic
1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG + Intronic
1176077505 20:63254970-63254992 AGCTCAGAGGTCCCCTCCACGGG + Intronic
1176289673 21:5037425-5037447 AAGCCATAGCTGCCCTCCCCAGG - Intronic
1177067832 21:16463135-16463157 AACTCACAGCTCCACATCACTGG - Intergenic
1178588901 21:33892902-33892924 AAACCACAGCTGCCATTCACGGG + Exonic
1179545777 21:42111451-42111473 AACCCACAGCTTCCCTCCTGGGG + Exonic
1179867557 21:44226162-44226184 AAGCCATAGCTGCCCTCCCCAGG + Intronic
1180994500 22:19958965-19958987 ACCCCACCGCCCCCCACCACAGG + Intronic
1183583616 22:38739669-38739691 CACCCACAGCTCTCCTCCCTGGG - Intronic
1183905824 22:41039475-41039497 GAGCCACAGCTCCCGGCCACAGG - Intergenic
1184670252 22:46008474-46008496 CACCCACAGCTGGCCTCCAGAGG + Intergenic
1184787654 22:46679482-46679504 AAACTACAGCTTCTCTCCACGGG - Exonic
949536718 3:5001960-5001982 AATCCAAAGTTCCCTTCCACAGG - Intergenic
949569216 3:5275685-5275707 AACTAACACCTCCCCTCCAAAGG - Intergenic
950660274 3:14462907-14462929 AACTCACAGCTCATCTTCACAGG - Intronic
952031968 3:29153916-29153938 AACCAATAGCTCCTCACCACAGG - Intergenic
952252083 3:31665147-31665169 AACACACAGCTTTCCTCCTCAGG + Intronic
952722190 3:36545117-36545139 AACTCACAGCTGCCCTTCTCAGG + Intronic
952917158 3:38255517-38255539 AACCCACAGCTCTCCGCCAACGG - Intergenic
952931101 3:38361646-38361668 CACCCACTGCTCACCTCCCCAGG - Intronic
953976290 3:47383989-47384011 AACCCTCAGCTCCAATTCACTGG - Intronic
954205713 3:49057492-49057514 AACCCGCCGCTCCCCTTCCCGGG + Exonic
955927519 3:64022892-64022914 AACCCAAATTTCCCTTCCACAGG + Intronic
957614084 3:82505953-82505975 AATCCGCAGCTCCTTTCCACAGG - Intergenic
961035346 3:123638004-123638026 AACCCTCAGCCCCCACCCACTGG + Intronic
961442971 3:126963679-126963701 AAGCCAGTGCTCCCCTCCCCAGG - Intergenic
962206579 3:133440039-133440061 AACCCACAGTTCCCCACGGCTGG + Intronic
962278002 3:134030162-134030184 AGCCCTCACCTCCCCTCCCCGGG - Intronic
964711637 3:159677312-159677334 CATCAACAGCCCCCCTCCACTGG - Intronic
968276715 3:197445886-197445908 AGGCCACAGCTCCCCACCTCAGG - Intergenic
968814588 4:2815301-2815323 CACCCACAGCCCCTCTCCAGAGG - Intronic
968902451 4:3438076-3438098 TACCAACTGCTGCCCTCCACAGG - Intronic
969802300 4:9578218-9578240 AAGCCACAGCTCCACTCCTGTGG - Intergenic
972331290 4:38066691-38066713 AGCCCCCAGCTCCCCTCCAGGGG - Intronic
972356226 4:38281439-38281461 AACCCACAGCTCACTTTCACAGG - Intergenic
981242417 4:142493266-142493288 ACCCCACATTTCCCTTCCACAGG - Intronic
983631833 4:169857240-169857262 TACCCACGGCTCACCTCCAGTGG + Intergenic
984928528 4:184826578-184826600 GGCCCTCAGCTCCCCTGCACCGG - Exonic
985631749 5:1017658-1017680 AGCCCACAGCCCCCCACCACGGG + Intronic
986782094 5:11075652-11075674 AGCTCACAGAGCCCCTCCACTGG - Intronic
986804850 5:11300147-11300169 AACCCTCAGATCCCTTCCATGGG + Intronic
987416110 5:17663500-17663522 CACTCACTGCTTCCCTCCACCGG + Intergenic
998216684 5:140242961-140242983 GACCCCCAGTTCCCCTCCAGGGG + Intronic
1000124104 5:158226778-158226800 AGCCCACAGCCTCCCCCCACTGG + Intergenic
1002047552 5:176550373-176550395 AGCACGCAGCTCCCCGCCACGGG - Intronic
1002074126 5:176698035-176698057 AACCCACAGCTTCCCTCCCAAGG - Intergenic
1008688794 6:53954082-53954104 AAGCCACAGCTCTCATCCACAGG - Intronic
1008695178 6:54027674-54027696 AACTCTCAGCTCCCCTCCCTGGG - Intronic
1011372310 6:86650409-86650431 AAAGCACAGTTCCCCTGCACAGG + Intergenic
1011665666 6:89630473-89630495 TTCCGACAGCTCCCCTCCAGTGG + Exonic
1015549221 6:134394718-134394740 AGTTCACAGCTCCCCTCCAGTGG + Intergenic
1016013775 6:139164149-139164171 AACCCACAGCACCCTCCCTCTGG + Intronic
1016334235 6:142987132-142987154 ACCCCACAGCTCCACTCCCTAGG + Intergenic
1018223684 6:161607080-161607102 ACCCTACACCTCCCCACCACTGG + Intronic
1020098885 7:5383348-5383370 GACCCAGGGCTCCCCTGCACAGG + Intronic
1020132959 7:5569905-5569927 AGCCCTCACCGCCCCTCCACTGG - Intergenic
1030125695 7:106150739-106150761 AACTCATTGCTCCACTCCACTGG - Intergenic
1032565519 7:132938681-132938703 AACTGACAGCTCTCCTCCACTGG + Intronic
1032708345 7:134441461-134441483 AACCCAGAGCCCCACTGCACAGG - Intergenic
1033989507 7:147265889-147265911 AAACCACAGCACCCCTACAGAGG + Intronic
1035308923 7:157952564-157952586 GACCCACAGCTCTGCACCACAGG - Intronic
1037634949 8:20693247-20693269 CTCCCACTGCTCCCCTCCCCAGG - Intergenic
1038658335 8:29474593-29474615 AACCCACAGCTCCCGACCCCAGG - Intergenic
1039407992 8:37329166-37329188 AGCCCAGAGCTCCCTGCCACTGG + Intergenic
1040481371 8:47831126-47831148 AGCCCAAAGCTCCCCTCCGAGGG + Intronic
1040568622 8:48588929-48588951 CTCCCCCAGCTCCTCTCCACTGG - Intergenic
1043954211 8:86342663-86342685 ACCCCACACCTCCCTTCCTCGGG - Intergenic
1046918160 8:119699363-119699385 CACCCCCAGGACCCCTCCACAGG + Intergenic
1047435922 8:124835382-124835404 AGGCCTCAGCTCCCCTCCACTGG + Intergenic
1048341831 8:133546128-133546150 AACTCACAACTCCTCTCCGCAGG + Intronic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049467160 8:142756843-142756865 AAACCACAGCTCCCTTTCCCAGG - Intergenic
1049830687 8:144699389-144699411 CACCCACAGCACCCCCACACCGG - Intergenic
1049849894 8:144825346-144825368 AATCCACAGAGCCCCTCCACAGG - Intergenic
1050294949 9:4195565-4195587 ATGCCCGAGCTCCCCTCCACGGG + Intronic
1051697781 9:19788393-19788415 AACCCACCGCTCGTCTCCCCGGG + Intergenic
1052965189 9:34335177-34335199 AACCCACAACTTCCTTTCACTGG - Intronic
1053022968 9:34708571-34708593 AAGCCACAGCTTCCCTCCTAGGG + Intergenic
1053168954 9:35864814-35864836 AAACCACAGCTCCCCTCACCTGG - Intergenic
1056779491 9:89538744-89538766 TGACCACAGCTCCCCACCACAGG - Intergenic
1057636390 9:96773176-96773198 ACACCACTGCTCCCCTCTACAGG - Intronic
1058119156 9:101119406-101119428 AGCCCTCTGCTGCCCTCCACTGG - Intronic
1059534019 9:115064394-115064416 AACACACAGCTCCCATGCAGAGG - Intronic
1060154235 9:121308141-121308163 AACCCACAGCTCCCTTGAAGGGG + Intronic
1060826621 9:126691648-126691670 AACCCGCAGCCCAGCTCCACAGG + Intronic
1061012686 9:127964694-127964716 GACACACATCTCACCTCCACTGG + Intronic
1062644069 9:137537742-137537764 AGCGCACAGCTCCCCTCTCCTGG + Intronic
1185431332 X:13629-13651 AACCCCCTGCTCCTCCCCACAGG + Intergenic
1185432155 X:17570-17592 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185432237 X:17762-17784 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185432319 X:17954-17976 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185432413 X:18178-18200 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185432495 X:18370-18392 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185440622 X:226090-226112 AACCCCCTGCTCCTCCCCACAGG + Intergenic
1185441472 X:230285-230307 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185441525 X:230415-230437 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185441622 X:230640-230662 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185441688 X:230801-230823 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185441715 X:230867-230889 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185441783 X:231028-231050 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185441810 X:231094-231116 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185441892 X:231286-231308 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1185441974 X:231478-231500 AACCCCCAGCTCCTCCCCTCGGG + Intergenic
1193716209 X:84937181-84937203 AACACCCAGCCCCCCTCCCCGGG - Intergenic
1201894645 Y:18980659-18980681 GACCCACTGCTCCCGGCCACAGG - Intergenic
1201938286 Y:19431426-19431448 AACCCACTGCCCTCCTCCCCTGG + Intergenic