ID: 1117947911

View in Genome Browser
Species Human (GRCh38)
Location 14:61049854-61049876
Sequence TTGTGAGAATGCAAGAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 285}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117947901_1117947911 22 Left 1117947901 14:61049809-61049831 CCCTCAGTCTTCTTTCCCCTTGT 0: 1
1: 0
2: 1
3: 48
4: 413
Right 1117947911 14:61049854-61049876 TTGTGAGAATGCAAGAACACTGG 0: 1
1: 0
2: 0
3: 22
4: 285
1117947902_1117947911 21 Left 1117947902 14:61049810-61049832 CCTCAGTCTTCTTTCCCCTTGTC 0: 1
1: 0
2: 5
3: 43
4: 510
Right 1117947911 14:61049854-61049876 TTGTGAGAATGCAAGAACACTGG 0: 1
1: 0
2: 0
3: 22
4: 285
1117947909_1117947911 5 Left 1117947909 14:61049826-61049848 CCTTGTCTGGGTTGAGGTTAGGG 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1117947911 14:61049854-61049876 TTGTGAGAATGCAAGAACACTGG 0: 1
1: 0
2: 0
3: 22
4: 285
1117947907_1117947911 6 Left 1117947907 14:61049825-61049847 CCCTTGTCTGGGTTGAGGTTAGG 0: 1
1: 0
2: 1
3: 18
4: 195
Right 1117947911 14:61049854-61049876 TTGTGAGAATGCAAGAACACTGG 0: 1
1: 0
2: 0
3: 22
4: 285
1117947906_1117947911 7 Left 1117947906 14:61049824-61049846 CCCCTTGTCTGGGTTGAGGTTAG 0: 1
1: 0
2: 2
3: 10
4: 91
Right 1117947911 14:61049854-61049876 TTGTGAGAATGCAAGAACACTGG 0: 1
1: 0
2: 0
3: 22
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117947911 Original CRISPR TTGTGAGAATGCAAGAACAC TGG Intronic
901437821 1:9259567-9259589 GTGTGACAATGTAACAACACTGG - Intronic
902846898 1:19118036-19118058 TAGTGAGAACTCAAGGACACAGG + Intronic
905920983 1:41718491-41718513 TAGTGAGACTTCAATAACACTGG + Intronic
909304535 1:74056739-74056761 TTCTGACAATCCATGAACACAGG - Intronic
909312896 1:74175641-74175663 TTGTGAGAATTCCAGAACCCAGG - Intronic
910000105 1:82331151-82331173 TTGTGAGTATGCAAAAAAAAAGG + Intergenic
910820441 1:91339197-91339219 TTGCCAGAAAGCAAGAACCCTGG + Intronic
911963733 1:104338864-104338886 TGGTGAGAATGCAAAAAAAGAGG - Intergenic
916138442 1:161673716-161673738 TTGTGAGCAGGCAGGAACAGAGG - Intronic
916555335 1:165889886-165889908 TGATGAGAATGCATGGACACAGG - Intronic
916670082 1:167009276-167009298 TTTTAAACATGCAAGAACACAGG - Intronic
917740346 1:177955691-177955713 TGGTGAGAATGTATGAAAACAGG + Intronic
921414817 1:214873175-214873197 TTATGTGAATGCAACAACACAGG + Intergenic
924147456 1:241090935-241090957 TTGTCATAATGAAACAACACAGG + Intronic
1063513665 10:6672386-6672408 TTGTGAGCATGCATGAAAAATGG - Intergenic
1064412442 10:15118765-15118787 TTGTGAGGATGCAAGGAAACAGG + Intronic
1064420221 10:15184618-15184640 TGGTGAGAATCCAGGCACACTGG - Intergenic
1065444365 10:25782338-25782360 TGGTGAGCATGCAATAAAACAGG - Intergenic
1067023061 10:42818871-42818893 GTGTGAGCATGCAGGCACACAGG + Intronic
1067821866 10:49538024-49538046 TTGTGAAAATGCAAGAAGGCTGG + Intronic
1070238041 10:74650904-74650926 TTCTGAGAATGAAAGAAGATGGG - Intronic
1073743505 10:106439406-106439428 CTGGGAGATTGCAAGAACCCAGG - Intergenic
1076518813 10:131066548-131066570 CTGGGAGATTGCAAGAACCCAGG + Intergenic
1078320340 11:10328825-10328847 TTGAGAGTATGCTAGAACACAGG + Intronic
1078609585 11:12808886-12808908 CTGTGAGAATGTGAGAATACAGG + Intronic
1079911180 11:26312043-26312065 TTGTGAGAATACTTGGACACCGG - Intronic
1081253965 11:40869945-40869967 TTCTGAGAAGGCAAGAACTGAGG + Intronic
1082616325 11:55364748-55364770 TTGTGATAATGCTACAACATTGG - Intergenic
1082626146 11:55488562-55488584 TTGTGATAATGCTAGAACATGGG - Intergenic
1085363130 11:75911143-75911165 GTTTGGGAATGCATGAACACTGG - Intronic
1086428705 11:86714532-86714554 TTGTAAGAAAGCAGAAACACAGG + Intergenic
1086988278 11:93273763-93273785 TTGTTAGAATGCAGGACCTCAGG + Intergenic
1087185305 11:95185780-95185802 TTTAGAGAATCAAAGAACACTGG + Intronic
1087821619 11:102718903-102718925 TTGTGGGAATGCAAGAGAAGAGG - Intronic
1088868821 11:113874742-113874764 TGGTGAGAGTGAAAGAACCCTGG - Intronic
1089023441 11:115242212-115242234 GTGTGAGAATGCAGGCCCACCGG + Intronic
1090724711 11:129514286-129514308 CTGTGAGAATACATGGACACAGG - Intergenic
1090972152 11:131653240-131653262 ATGTGAGACTGAAAGAACAAAGG - Intronic
1092072428 12:5642539-5642561 TTGTGATAATGCAAGAAGTGCGG - Intronic
1092660382 12:10732436-10732458 TTGTGAGAATCCAAGCCCACTGG + Intergenic
1092952337 12:13518083-13518105 TTATGAGAACACATGAACACAGG - Intergenic
1093606052 12:21089254-21089276 TAGAGAGCATGCAAGAACAGGGG - Intronic
1093656279 12:21697992-21698014 TGGTGAAAATGCAAGAAAACAGG - Intronic
1093660613 12:21752532-21752554 TTGGGAGAATGAAAAGACACAGG + Intronic
1094653358 12:32399129-32399151 CTGCGAGAATGCAAGCACCCTGG + Intergenic
1094702228 12:32880973-32880995 TGTTGAGAATACAACAACACAGG + Intronic
1095229825 12:39726356-39726378 TTGTGAGAACACATGCACACAGG - Intronic
1095976778 12:47945619-47945641 TTGTGATCAGGGAAGAACACAGG + Intergenic
1098864992 12:75752169-75752191 TTGTAAGAAGGAAAGAACAAAGG - Intergenic
1100116085 12:91306214-91306236 TAATGAGAATGCATGGACACAGG + Intergenic
1106385758 13:29283922-29283944 TTGTGAGGCTGCAAGCAAACAGG + Intronic
1106638623 13:31559015-31559037 TTGTGGGAATGCAATAAAAATGG + Intergenic
1107432792 13:40355040-40355062 TTGTCAGAATGCAAGTTCTCAGG + Intergenic
1107736106 13:43400047-43400069 TGGTGAGAATGAAAGGACAAGGG - Intronic
1109007266 13:56893939-56893961 TTCTGAGAAGGCAAGAACTGAGG - Intergenic
1109176824 13:59167440-59167462 TTCTGAGAAGGCAAGAACTGAGG - Intergenic
1109676003 13:65676292-65676314 TTGGAAGAATACAAGAACAAGGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110479703 13:75960134-75960156 ATGTGAGAATCCAGGGACACAGG + Intergenic
1110750359 13:79107643-79107665 TGATGAGAGTGCATGAACACAGG + Intergenic
1111135395 13:84036140-84036162 TTCTGAGAACGCAAGAACTGAGG - Intergenic
1111170870 13:84524657-84524679 TTGTTAGCTTGCAAGAACAAAGG + Intergenic
1111667595 13:91288757-91288779 TGGTGAGAGGGCAAGAGCACAGG - Intergenic
1112108490 13:96268196-96268218 GTGTGAGAATGGACTAACACAGG - Intronic
1112633465 13:101187734-101187756 AAGTGAGAGTGTAAGAACACAGG + Intronic
1114900861 14:27056062-27056084 TTATGAAAATACATGAACACAGG + Intergenic
1115089956 14:29562533-29562555 TAGTGAGAATGCAGAAAAACTGG + Intergenic
1115885011 14:37961590-37961612 TAGTGAGAATGCAAGAGTAGAGG + Intronic
1117947911 14:61049854-61049876 TTGTGAGAATGCAAGAACACTGG + Intronic
1118226041 14:63900192-63900214 TTGTGAGATTGCAAGCCCAGTGG + Intronic
1119961273 14:78859310-78859332 GTGTGAGAATGGACCAACACTGG + Intronic
1120776019 14:88438995-88439017 GGGTGTGAATGCCAGAACACAGG + Intronic
1123216504 14:106813451-106813473 TTCGGAGCATGCAAGAGCACAGG - Intergenic
1129095739 15:73205569-73205591 TTGTGAGAATGAAAAAATCCTGG - Intronic
1129184941 15:73900225-73900247 TTGTGAGAATGAAACAAGACAGG + Intergenic
1129710391 15:77817853-77817875 TTGTGAGAATGCAGGACCGGTGG - Intronic
1130542259 15:84828728-84828750 TTGTAAGAATGCAATGACAATGG - Intronic
1130754866 15:86752550-86752572 TAGGGAGAATGCAGGAGCACAGG + Intronic
1131978839 15:97975290-97975312 TTTTGAGAATGCTAGAAAAATGG + Intergenic
1135115503 16:19719765-19719787 GTGTGAGAATGCTTGAACCCGGG - Intronic
1137000255 16:35222918-35222940 TTTTTAGAATCCATGAACACAGG - Intergenic
1137013323 16:35345426-35345448 TTTTTAGAATCCATGAACACAGG - Intergenic
1137033384 16:35545345-35545367 TTTTTAGAATCCATGAACACAGG - Intergenic
1138627812 16:58266453-58266475 CTGTGAGAATGCCAGGACAGTGG - Intronic
1138753611 16:59454800-59454822 TTGTGAGAATTCTAGAATCCAGG - Intergenic
1139206749 16:65036472-65036494 TTGTGAAAATGCCAGAACTCAGG + Intronic
1139262475 16:65608095-65608117 TTGGGAGAAAGCCAGAACATAGG + Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1140049147 16:71464186-71464208 TTATAAGAATGGAAGAACAGGGG - Intronic
1140430026 16:74894835-74894857 TTGTGAGATTGGAACAACAGAGG - Intronic
1140585776 16:76290104-76290126 GTGTGAGAATAAAATAACACAGG - Intronic
1141393708 16:83685998-83686020 TTATGAAAATACAAGAAGACTGG - Intronic
1141666093 16:85466103-85466125 CTGTGGGAATGTGAGAACACGGG + Intergenic
1203122153 16_KI270728v1_random:1548018-1548040 GTGTGAGCATGCAGGCACACAGG - Intergenic
1144829796 17:18124845-18124867 TTGTGAGGATGCCAGCACATTGG + Intronic
1146994204 17:37303934-37303956 TTGTGAGAATGCAGAAAAATTGG - Intronic
1147038909 17:37702129-37702151 TTCCCAGAAAGCAAGAACACAGG - Intronic
1147522938 17:41191935-41191957 CTGTGAGAATACATGGACACAGG + Intronic
1150504098 17:65680893-65680915 TTGTGAGAACTCACTAACACAGG + Intronic
1151183832 17:72349379-72349401 TTGTGAGAATGCAAGGGAAAGGG - Intergenic
1152137343 17:78512265-78512287 ATGAAAGAATGCAAGAACAACGG - Intronic
1154366716 18:13716904-13716926 GTGTGAGAATGGACTAACACAGG + Intronic
1155749921 18:29409120-29409142 TGGTGAGAATGCAAAAAAACTGG - Intergenic
1156655764 18:39284101-39284123 GTGTGAGAATGGACGAATACAGG + Intergenic
1157008791 18:43620992-43621014 TGTTGAAAATGCAAGACCACAGG + Intergenic
1157032942 18:43935255-43935277 GTGTGAACATGTAAGAACACTGG + Intergenic
1159887663 18:73924434-73924456 ATGTGAGATGGCAAGACCACTGG + Intergenic
1160574782 18:79847025-79847047 TTGTGAAGATGCCAGAACAGAGG + Intergenic
1161662315 19:5554457-5554479 TTGTGAGAATACAAAACAACAGG + Intergenic
1163610068 19:18295980-18296002 TTGAGTGAATGGATGAACACAGG - Intergenic
1164243949 19:23414737-23414759 TTTTGAGAATGTAGGAACAAAGG + Intergenic
1164571855 19:29380474-29380496 CTGGGAGATTGCAAGAACCCAGG + Intergenic
1164965413 19:32479018-32479040 TGGTGAGGATGAAGGAACACAGG - Intronic
1166023830 19:40060090-40060112 TTGTCAGAAGCCAAGAACAAAGG + Intergenic
925978692 2:9159254-9159276 TGGTGAGAATGCACGGAAACTGG - Intergenic
926135089 2:10330857-10330879 TTGTGAGAATGCAGGTTCCCAGG + Intronic
927003826 2:18826879-18826901 TGATGAGAATGCATGGACACAGG - Intergenic
927059984 2:19408030-19408052 TTGTGAGAATGAAAAAAGATGGG + Intergenic
928800523 2:35084555-35084577 TTGTGAGGATGCAGAAAAACTGG + Intergenic
930149084 2:48039848-48039870 TTAGAAGAATGCAAGAAGACTGG - Intergenic
930981875 2:57535359-57535381 TTGTAGGAATGCAAGAACGGAGG - Intergenic
931460248 2:62443953-62443975 GTGTGAGAAAGCCAGAACCCAGG - Intergenic
931496515 2:62813303-62813325 CTGTAAGAATGCAAGAACTTTGG + Intronic
935347057 2:102118229-102118251 TTGTAAGAATCCCAGAACTCTGG + Intronic
935641540 2:105295207-105295229 TTCTGAAAATGAAAGAAGACAGG - Intronic
936341205 2:111633938-111633960 TTTTGAGAACCCAAGAACTCAGG - Intergenic
936674438 2:114698765-114698787 CTGTGAAAATGCAAGAAGCCAGG - Intronic
937639140 2:124192035-124192057 TCATGGGAATGAAAGAACACAGG - Intronic
939840492 2:147182126-147182148 TTGTGAGAAAACAAGAAACCAGG + Intergenic
939929598 2:148216771-148216793 TTGTGAGAAAGGAGAAACACGGG - Intronic
943340982 2:186681974-186681996 TTGTGAAAATGCAAGAAAAGGGG + Intergenic
944167178 2:196735245-196735267 GTGTGAGAATGGACTAACACAGG + Intronic
944252921 2:197595539-197595561 TTGTGAGAAGGCAAATACATGGG + Intronic
945427033 2:209719052-209719074 TTTTCATAATGCAAGAACAAAGG + Intronic
945647211 2:212512534-212512556 TTGTGAGAAGGCAAGAAATGAGG - Intronic
946470058 2:219951126-219951148 TTGTGATAATGAGAAAACACTGG + Intergenic
947599845 2:231440095-231440117 TTCTGAGAAGGCAAGAACGGAGG + Intergenic
947941626 2:234061343-234061365 TTGTATAAATGCAAGAAAACTGG + Intronic
1170020805 20:11834677-11834699 TTGTGAGAAGGCAAGTATATGGG - Intergenic
1170138476 20:13101791-13101813 TTGTCAGAATGCAGGATCTCAGG - Intronic
1170167342 20:13375277-13375299 CAATGAGAATGCATGAACACAGG - Intergenic
1170325957 20:15154631-15154653 TTGTGAGGATGCAACAAGACGGG - Intronic
1173573265 20:44092285-44092307 TTCTGAGAATGAAAACACACTGG + Intergenic
1174045789 20:47731806-47731828 TGGTGAGAATGTAGGAAAACAGG - Intronic
1174849167 20:53975284-53975306 CTGGCAGCATGCAAGAACACAGG + Intronic
1175482895 20:59323979-59324001 TTGCAAGAAAGCAAGAACATTGG - Intronic
1175652079 20:60734159-60734181 TTGGGAGAATGCAAGGTCCCAGG + Intergenic
1177247964 21:18554790-18554812 TTGTGAGAATACAGAAAAACTGG - Intergenic
1178154046 21:29831398-29831420 ATGTGAGAATGGACGAATACAGG - Intronic
1179274766 21:39882203-39882225 GTGTGAGAAAGAAAGCACACAGG - Intronic
1180641075 22:17299838-17299860 TTGGGATAATAAAAGAACACGGG + Intergenic
1182700800 22:32236469-32236491 TTGTTAGAATACACAAACACAGG + Intronic
1183445733 22:37853147-37853169 TTGTGAGGAGGCAAGAACTGAGG - Intronic
1184199166 22:42953841-42953863 TTGTGTGATTACAAGGACACTGG + Intronic
1184956429 22:47889906-47889928 GTGTGAGAATGGAGGAATACAGG + Intergenic
950851402 3:16065273-16065295 TTGAGAGAATGAAAGAAGAAAGG + Intergenic
951083058 3:18475562-18475584 TTGTGAGAACACTAGAACACTGG + Intergenic
952337699 3:32419070-32419092 TGGTGAAAATGATAGAACACTGG - Intronic
953038396 3:39233475-39233497 TTGGGAGATTACAAGAACCCAGG + Intergenic
953150984 3:40324203-40324225 TTGTGAGACTGCAAACACCCGGG - Intergenic
953812368 3:46124242-46124264 TTTTGAGAAGGCAAGAACTGAGG + Intergenic
954610200 3:51941076-51941098 TTGTGAAATTGCAGGAAAACTGG + Intronic
955113384 3:55972471-55972493 TAGTGAGAATCCATGGACACAGG - Intronic
956243952 3:67160216-67160238 TAATGAGAATGCATGGACACAGG + Intergenic
957544251 3:81615903-81615925 TGGTGAGGATTCAAGAAGACTGG - Intronic
957567108 3:81898084-81898106 TTGTGTGAATGAAAGAAGGCAGG - Intergenic
957899425 3:86469443-86469465 TTATGAAAATGCAAGAACTCAGG - Intergenic
959389877 3:105760041-105760063 TTATAAGATTGCAGGAACACAGG + Intronic
959608622 3:108269075-108269097 ATGTGACAATGCTAGGACACAGG + Intergenic
959777623 3:110187689-110187711 GTGTGAGAATGGACTAACACAGG - Intergenic
959820657 3:110731108-110731130 TTGTGGTAATGCAAGAAAATTGG + Intergenic
959980421 3:112510193-112510215 CTGTGAGGATGCAACAACAAAGG + Intergenic
960168316 3:114429078-114429100 TAGTGAAAATGCTACAACACCGG - Intronic
963517914 3:146331767-146331789 TTGTGTGATTGCAAGAATACTGG + Intergenic
963908309 3:150792473-150792495 TTGTGAGAAGGCAAGATCAGGGG - Intergenic
964249798 3:154699769-154699791 TTCTGAGAAGGCAAGAACTGAGG + Intergenic
965637630 3:170800304-170800326 TTGTGAGGATGCAAAAGCATAGG - Intronic
965747635 3:171942018-171942040 TGGGGAGAAAGCAACAACACTGG - Intergenic
967120875 3:186381758-186381780 TTGTGAGGAAGCAAGAACTGAGG + Intergenic
967521113 3:190434121-190434143 ATGTGAGAATGGACTAACACAGG + Intronic
969579686 4:8057569-8057591 TGGTGAGAAGTCAAGGACACAGG - Intronic
970453858 4:16201928-16201950 TTGTGAGAGTGGAAAAACTCTGG - Intronic
970841255 4:20473211-20473233 TTGAGATAATGCAAGCAAACTGG - Intronic
971236457 4:24846738-24846760 TTGTGATATTGCATAAACACAGG - Intronic
972468644 4:39383297-39383319 GTGTGAGTCTGCAAGAACAACGG - Intergenic
972759398 4:42088414-42088436 GTGTGAGAATGGACTAACACAGG - Exonic
974837152 4:67264795-67264817 TTGTGAGAGTGCAAGAAACCTGG - Intergenic
975167112 4:71188472-71188494 TAATGAGAAATCAAGAACACTGG + Intronic
975425555 4:74222759-74222781 TTTTGAAAATGCAAGAATTCAGG - Intronic
976818275 4:89175242-89175264 TTCTGAGAAGGCAAGAACTGAGG + Intergenic
977695169 4:99956875-99956897 TTCTGAGAAAGAAAGAATACAGG + Intergenic
978608932 4:110515387-110515409 TTTTGAGAATGCTTGAAGACTGG + Exonic
978711947 4:111793594-111793616 CTGTGGGAATGGAAGAACAGAGG - Intergenic
978840475 4:113206287-113206309 TAATGAGAATGCATGGACACAGG - Intronic
978931984 4:114325111-114325133 TTCTGAGAAGGCAAGAACTGAGG + Intergenic
979103987 4:116661156-116661178 CTATGAGAACGCACGAACACAGG + Intergenic
979711910 4:123789707-123789729 CTGTGAGAATACATGGACACAGG - Intergenic
980198452 4:129622453-129622475 TTGAGATCATGCAAGAAAACTGG - Intergenic
980211259 4:129791258-129791280 GTGTGAGAAGGAAAGAACAGAGG - Intergenic
980526941 4:134001561-134001583 TTGTGAGAATGAAAGAAGTTGGG + Intergenic
981591820 4:146372514-146372536 TTCTGAGAAGGCTAGAACAAAGG - Intronic
983850828 4:172578742-172578764 AAGTGAGAATGTAAGAAGACTGG - Intronic
984230791 4:177096352-177096374 CAGTGAGAATGCAAGGACAATGG + Intergenic
984364320 4:178778627-178778649 TTGTGAAAAAGAAAGAAGACTGG - Intergenic
984563223 4:181295902-181295924 TTGTTAAAATGCAAGCACATGGG + Intergenic
984594661 4:181653907-181653929 CTGTGAGAACGCATGGACACAGG - Intergenic
985070330 4:186161332-186161354 TTGTGAGACTGAAGGGACACAGG + Intronic
985209261 4:187574284-187574306 TGGTGAGGATGCAAGAAAAAGGG - Intergenic
985751163 5:1676553-1676575 TAGTGAGAATACAAGAAAAAGGG + Intergenic
989755817 5:44952489-44952511 TTGTGAGAATGTGGGAACATTGG - Intergenic
995350679 5:111171842-111171864 TTGTTAAATTGCACGAACACTGG + Intergenic
995822859 5:116257163-116257185 CTGTCAAAATGCAGGAACACAGG - Intronic
996304910 5:122036025-122036047 TTGGGAGAATACAAGTATACAGG + Intronic
997079626 5:130723273-130723295 GTGTGAGAATGGACTAACACAGG - Intergenic
999529424 5:152446053-152446075 TTGGGAGGATGCATGCACACAGG + Intergenic
1000517561 5:162258071-162258093 TTGTAAAGATGTAAGAACACAGG - Intergenic
1005196074 6:23285854-23285876 TTGCAAGAATTCAGGAACACCGG + Intergenic
1006260620 6:32866226-32866248 TTGTGATAAGGCAAGACCCCTGG + Intergenic
1007051290 6:38833004-38833026 TAGTGAGAATGCAAAATCAATGG - Intronic
1007484647 6:42172617-42172639 GTGTGAGAGTGCAGGCACACAGG - Intronic
1010101649 6:72116406-72116428 TTGTCAGAATCCAAGAAAACTGG + Intronic
1010462376 6:76128069-76128091 TTGTGACAATGAAAGAAAAAAGG - Intergenic
1010830419 6:80521384-80521406 ATGTAAGCATTCAAGAACACTGG - Intergenic
1010837570 6:80609054-80609076 TTGTGTGATTCCAATAACACTGG - Intergenic
1011030923 6:82921644-82921666 TTGTGAGAATTCCTGATCACAGG + Intronic
1012170450 6:96011159-96011181 TGGTGAAGATGCAAGAACTCAGG - Intergenic
1012298663 6:97556645-97556667 TTGTAAGAATGCACAAACAATGG - Intergenic
1012802163 6:103844216-103844238 TTGTGAAAATCCAAGTGCACAGG + Intergenic
1013406565 6:109849091-109849113 ATTTGAGAATGCCAGAACAGAGG + Intergenic
1014059210 6:117051184-117051206 TTATGAGGATACAAGAAGACAGG - Intergenic
1014265357 6:119270670-119270692 TTGTCAGCATGCAAGAACTTGGG - Intronic
1014586095 6:123199697-123199719 CAATGAGAATGCATGAACACAGG - Intergenic
1014918534 6:127183818-127183840 GTGTGAGAATGCACTAATACAGG - Intronic
1015440947 6:133245094-133245116 TTAGGTAAATGCAAGAACACTGG + Intronic
1015846976 6:137530958-137530980 TGATGAGAATGCATGGACACAGG - Intergenic
1017850788 6:158303799-158303821 TTGTAAGAATGCAACCACTCTGG - Intronic
1021265621 7:18517727-18517749 GGGTGAGAATGGAAGAAAACAGG - Intronic
1021628897 7:22624067-22624089 TTTTGAGAATGAAATAAAACAGG - Intronic
1021939151 7:25662649-25662671 TTGTGAGCATGCCAGTACACAGG - Intergenic
1022523719 7:31023923-31023945 TTGTGAGAAGGGACGAATACAGG - Intergenic
1022768136 7:33438793-33438815 TGCTGAGAAAGAAAGAACACAGG + Intronic
1023188240 7:37553111-37553133 TTGTGAGAATCCAGGAAGAAGGG + Intergenic
1024192579 7:47027824-47027846 TTGTGAGCATGCAACACCCCTGG + Intergenic
1024338209 7:48230952-48230974 TAATGAGAATGCATGGACACAGG + Intronic
1024378659 7:48668640-48668662 TTTTGAGACTTCAAGAAGACAGG - Intergenic
1026491876 7:70870519-70870541 TGATGAGAATGCACGGACACAGG - Intergenic
1028114885 7:86985861-86985883 TTGAGAGAATACATGGACACAGG - Intronic
1028136260 7:87226205-87226227 TTGTGAGAAGACAACAAAACTGG + Intergenic
1028925690 7:96354958-96354980 GTGTGAGAATGGATGAATACAGG - Intergenic
1031554607 7:123157071-123157093 TTGTAAGAAAGCAGAAACACAGG - Intronic
1031594488 7:123633043-123633065 TTGTCAGCATGCAAGAACTCAGG + Intronic
1031940354 7:127782346-127782368 ATGTGAGAATGCAGGACCCCAGG - Intronic
1032796967 7:135285615-135285637 TTGTGAGAATGTAAAATAACTGG + Intergenic
1032897329 7:136265641-136265663 CAGTGAGAATGCATAAACACAGG - Intergenic
1033338402 7:140472686-140472708 TTGTAACAATGCAAAAACAAGGG - Intronic
1034298933 7:149998378-149998400 GTGTGAGAATGGACGAATACAGG - Intergenic
1034820559 7:154212782-154212804 TTGTTAGAATGCAAGATGGCAGG + Intronic
1035842687 8:2829262-2829284 CTCTGAGAAGGCAAGGACACAGG - Intergenic
1035956208 8:4082808-4082830 TAATGAGAATGCATGGACACAGG - Intronic
1036708619 8:11062991-11063013 ATGTGAGGATTCAAGAACCCAGG - Intronic
1037043731 8:14270994-14271016 CAGTGAGAACGCAAGGACACAGG + Intronic
1037701114 8:21274565-21274587 TGGTGAAACTGAAAGAACACTGG + Intergenic
1037732523 8:21539775-21539797 TGATGAGAATGCAGGAAAACTGG - Intergenic
1038264080 8:26023612-26023634 TTGTGAGAAAGCAGAAACTCAGG - Intronic
1040311223 8:46237860-46237882 CTGTGAGAATGCAGGAATGCTGG + Intergenic
1040534917 8:48300689-48300711 TTTTCACAATGGAAGAACACGGG - Intergenic
1041501301 8:58541742-58541764 ATGTAAGAAAGCAAGAAGACTGG + Intergenic
1041540924 8:58984119-58984141 TGGTGTGACTCCAAGAACACAGG + Intronic
1042165365 8:65940453-65940475 TTTTGATAATGTAAGAATACTGG + Intergenic
1045569481 8:103354246-103354268 TGGTGAGTAGGCAGGAACACAGG - Intergenic
1045657146 8:104398988-104399010 TTGGAAGAAAGCAAGAAAACAGG + Intronic
1046473956 8:114716204-114716226 GTGTGAAAAGGCAAGAAAACAGG - Intergenic
1046524137 8:115362256-115362278 TTGGGAGAATGTAAGCTCACAGG - Intergenic
1046634082 8:116652842-116652864 TCCTGAGAAGGCAAGAAGACAGG + Intronic
1047374244 8:124281149-124281171 TTGTGAGAATGGACTAATACAGG - Intergenic
1047747947 8:127859241-127859263 TTCTAAGAATACAACAACACAGG - Intergenic
1050624033 9:7484825-7484847 CAGTGAGAATGCATGGACACAGG + Intergenic
1051234800 9:14988167-14988189 TGGTGAGAATGTAAGAAAAAGGG + Intergenic
1055169382 9:73236433-73236455 TTGTGAGACTATAAGAAAACAGG - Intergenic
1055344597 9:75321902-75321924 CAGTGAGAATGCATGGACACAGG - Intergenic
1056571113 9:87815877-87815899 TTTTTCTAATGCAAGAACACAGG - Intergenic
1057829832 9:98397952-98397974 GTGGGTGAATGCAAGAATACAGG - Intronic
1059092443 9:111374249-111374271 TTGTGAAAAAGAAAGAAAACTGG + Intronic
1060316213 9:122513501-122513523 TTGTGAAAATACATGAACAATGG - Intergenic
1062418246 9:136464874-136464896 TTGTGAAAATGGAAGAGCTCGGG - Intronic
1185815109 X:3147362-3147384 CTGTGAGTTTGCAAGGACACTGG + Intergenic
1185968639 X:4636418-4636440 TATTATGAATGCAAGAACACTGG + Intergenic
1186352301 X:8752177-8752199 TTGTGAGTATGTGAGACCACAGG - Intergenic
1186741250 X:12520711-12520733 TTCTGAGAATGCTGGGACACAGG - Intronic
1189683868 X:43543898-43543920 TTGTGAGGAGGCAAGAACTGAGG - Intergenic
1191958795 X:66676425-66676447 TTGTGAGAATTAAATAAGACAGG + Intergenic
1192307203 X:69974083-69974105 TTGAGGGAATGAATGAACACAGG + Intronic
1193490419 X:82142693-82142715 CTGTGAGGATTCAAGAAAACCGG + Intergenic
1195199619 X:102535269-102535291 CAGTGAGAATGCATGAACACAGG + Intergenic
1196331350 X:114472901-114472923 TTGTGAATATGCAAGAATTCAGG + Intergenic
1197326422 X:125099805-125099827 TTCTGAGAATGGCAGAACCCTGG + Intergenic
1197527350 X:127578590-127578612 GTGTGAGTAAGCAAGCACACAGG - Intergenic
1197641953 X:128976819-128976841 TTGTGAGGTTGGAAGATCACAGG + Intergenic
1198457993 X:136836266-136836288 GTGTGAGAATGGAATAATACAGG + Intergenic
1198810937 X:140535659-140535681 TAGTTAGAATGAAAGAACAAAGG - Intergenic
1201015728 Y:9599544-9599566 GTGTGAGAATGGACTAACACAGG + Intergenic
1201266175 Y:12209345-12209367 CTGTGAGTTTGCAAGGACACTGG - Intergenic
1201535710 Y:15045984-15046006 GTGTGAGAATGAAATAATACAGG + Intergenic
1201629023 Y:16048741-16048763 CTGTGAGAATGGACTAACACTGG - Intergenic
1201642613 Y:16195588-16195610 AGGTGAGACTACAAGAACACAGG + Intergenic
1201660202 Y:16389733-16389755 AGGTGAGACTACAAGAACACAGG - Intergenic
1201855767 Y:18539582-18539604 ATGTGGGAATGCATGGACACAGG - Intergenic
1201877554 Y:18780803-18780825 ATGTGGGAATGCATGGACACAGG + Intronic