ID: 1117949243

View in Genome Browser
Species Human (GRCh38)
Location 14:61064439-61064461
Sequence CATGATCCTATCTCATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117949243_1117949249 -6 Left 1117949243 14:61064439-61064461 CCTGCTCATGAGATAGGATCATG 0: 1
1: 0
2: 0
3: 11
4: 53
Right 1117949249 14:61064456-61064478 ATCATGGGAGGTTTGGCAAAGGG 0: 1
1: 0
2: 2
3: 13
4: 166
1117949243_1117949248 -7 Left 1117949243 14:61064439-61064461 CCTGCTCATGAGATAGGATCATG 0: 1
1: 0
2: 0
3: 11
4: 53
Right 1117949248 14:61064455-61064477 GATCATGGGAGGTTTGGCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117949243 Original CRISPR CATGATCCTATCTCATGAGC AGG (reversed) Intronic
900902322 1:5525596-5525618 CTTGATCCTATCTCAAAAGATGG - Intergenic
911533370 1:99072461-99072483 TCTGATCCTATCTGATGAACTGG - Intergenic
911908152 1:103595329-103595351 AAAAATCCTATCTCATGAGGTGG + Intergenic
911913686 1:103667810-103667832 AAAAATCCTATCTCATGAGGTGG + Intronic
911914766 1:103684137-103684159 AAAAATCCTATCTCATGAGGTGG - Intronic
1063382245 10:5592750-5592772 CATGGTCCTATGTCAGGAGCTGG + Intergenic
1072790672 10:98315459-98315481 CATGCTCCTACCTCATCACCAGG - Intergenic
1075331164 10:121575069-121575091 CATGATCCCATCTGATGACTAGG - Intronic
1080074564 11:28134150-28134172 CATGTTCTTGTCTCATGACCAGG + Intronic
1084607984 11:70183721-70183743 CCTGATCCTATCTCAGGAGTTGG + Intronic
1087101251 11:94367353-94367375 CATGCCCCCAACTCATGAGCAGG - Intergenic
1089302385 11:117506416-117506438 CATGGTCATATCTTATGAACTGG - Intronic
1091610023 12:1998992-1999014 CATGATCCTTTCACATGCTCAGG + Intronic
1092629698 12:10364275-10364297 AATGAGCCTCTCTCATGACCTGG - Intergenic
1094672329 12:32582474-32582496 CATGAGACTAGCTCATGAGCAGG + Intronic
1096553565 12:52389922-52389944 CAGGATCCTATCTGTGGAGCAGG + Intergenic
1101763594 12:107679039-107679061 CAGGATCCTATCTCAGGAGTCGG + Intergenic
1106785454 13:33103737-33103759 TAGGATCCCATCTCAGGAGCAGG + Exonic
1107790336 13:43995557-43995579 CATGATCCCCTCTCAAGTGCTGG - Intergenic
1108918889 13:55652999-55653021 CACGAACCTATCCCATCAGCAGG + Intergenic
1110565470 13:76953374-76953396 CTTGATCCTAGATCATGATCCGG - Intronic
1111521736 13:89413615-89413637 CTTGATCAGATCTCAAGAGCTGG - Intergenic
1114646328 14:24258526-24258548 CATGATTCTGTCTGGTGAGCTGG - Exonic
1117949243 14:61064439-61064461 CATGATCCTATCTCATGAGCAGG - Intronic
1118357299 14:65025262-65025284 CACGATTCTATCTTAGGAGCTGG + Intronic
1141089667 16:81121555-81121577 CATGCTCATAGCTCATGAGCAGG - Intergenic
1143523991 17:7462113-7462135 CATGGTCCTACCTGATGAGAAGG - Exonic
1143585486 17:7848352-7848374 CAAGATCCTACCTGATGGGCTGG + Exonic
1154247845 18:12715359-12715381 CATGACACTATCTTATGAGCTGG - Intronic
1155621173 18:27782115-27782137 CACGATCCTCTCTAGTGAGCTGG + Intergenic
1159254243 18:65925133-65925155 CATAATCAGATCTCCTGAGCAGG - Intergenic
1159929715 18:74297994-74298016 CATGTTCCTGTCTCATTAACAGG - Intergenic
925150452 2:1611554-1611576 CAGGATCCCATCGAATGAGCAGG + Intergenic
925150500 2:1611755-1611777 CAGGATCCCATCGAATGAGCAGG + Intergenic
933415446 2:81981787-81981809 AATGAGCCTACCTGATGAGCAGG + Intergenic
935700611 2:105808509-105808531 AAAGATCCTTTCTCAAGAGCAGG - Intronic
947462084 2:230312174-230312196 CATGATCCTTTCTTATTAACAGG - Intronic
947471165 2:230402386-230402408 CATGATCCTTTCTTATTAACAGG - Intronic
1170069423 20:12348834-12348856 CATGCCCCTCTCTCATCAGCTGG + Intergenic
1173417564 20:42870695-42870717 CATGATTCTATTTCAAGAACTGG + Intronic
1175259412 20:57665152-57665174 CATGATTCTAACACATGACCCGG + Intronic
1176294295 21:5062801-5062823 CATGATCCTGTGGCACGAGCAGG - Intergenic
1177278444 21:18947404-18947426 CCTGATAAGATCTCATGAGCTGG + Intergenic
1178481224 21:32980853-32980875 CTTGATCCTATATCATAAGGTGG + Intergenic
1179862965 21:44200847-44200869 CATGATCCTGTGGCACGAGCAGG + Intergenic
958568656 3:95850300-95850322 TATGATCATATCTCATGCGGAGG + Intergenic
959963268 3:112324985-112325007 CATATTCCAATCTCATGAGCTGG - Intergenic
960969800 3:123131256-123131278 CAAGACCCTGTCTCATTAGCCGG + Intronic
964762257 3:160145708-160145730 CAAGCTCCAATCTCATGACCTGG + Intergenic
975871077 4:78778797-78778819 CATGACCCAATCTTATGATCAGG - Intronic
993039842 5:82801755-82801777 GATGATCCTATCTTATAAGAAGG - Intergenic
997850499 5:137328457-137328479 CCTGAACCTAGCTCCTGAGCAGG + Intronic
1004643803 6:17540363-17540385 CATGATCCTTTTTCGTGAGGTGG + Intronic
1008655079 6:53603841-53603863 CATGATCCCTTCTCGTTAGCTGG + Intronic
1016742940 6:147547470-147547492 CATGGTCCACTCTCTTGAGCTGG + Intronic
1017600973 6:156080978-156081000 CATAATCCTATCCCATGGGAGGG + Intergenic
1022176862 7:27879638-27879660 CATGACCCTATATCTTGAGCAGG - Intronic
1035922407 8:3691983-3692005 CAGCATCCTGTCTCATGAGCTGG - Intronic
1039701079 8:39962552-39962574 CAGGATCTTGTCTCATGACCAGG + Intronic
1040467015 8:47704807-47704829 TATCCTCCTATCTCCTGAGCCGG - Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1059566017 9:115383551-115383573 CATGTTGCTATCTCATGGCCAGG - Intronic
1061647871 9:132020622-132020644 CATGATTCTTTCTCATTAGCTGG - Intronic
1061735206 9:132650694-132650716 CATGATCCAATTTGGTGAGCTGG + Intronic
1190242773 X:48670696-48670718 CAGGAACCCATCTAATGAGCTGG - Intergenic