ID: 1117949380

View in Genome Browser
Species Human (GRCh38)
Location 14:61066198-61066220
Sequence TATTTTTTCCATAAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117949380 Original CRISPR TATTTTTTCCATAAGGAGGT AGG Intronic
900504086 1:3020585-3020607 CACTTTTTTCCTAAGGAGGTTGG - Intergenic
902966761 1:20010618-20010640 TAGCTGTCCCATAAGGAGGTTGG + Intergenic
903888121 1:26552976-26552998 TACTTTTTACATAAGGAAATGGG - Intronic
903918612 1:26783276-26783298 TATTGTTTCCCTAAGGAAGGGGG - Intergenic
904845434 1:33410099-33410121 CATTTTTTCCATAAAGGAGTGGG - Intronic
909682178 1:78303948-78303970 TCTTTCTTCCAAAAGGAGTTTGG + Intronic
910322126 1:85958174-85958196 TATTTTTTCCATAGCAAGGTAGG + Intronic
911521841 1:98939276-98939298 TAATTTTTCCATATAGAGGAAGG + Intronic
912695395 1:111837916-111837938 TATTTTTTTCATAATGAGACTGG + Intronic
913349375 1:117841336-117841358 TATTATTTCCATCAGGATATAGG + Intergenic
915725650 1:158015155-158015177 GATTATTTCCCTAAGGAGATGGG - Intronic
916373101 1:164121591-164121613 TAATTTTTCCATAAGGTGTAAGG - Intergenic
916526034 1:165610318-165610340 TATGTTTTCCAAATGGAGGGCGG - Intergenic
918739423 1:188108236-188108258 TATTTTTTAAATAAGGGAGTAGG - Intergenic
920795244 1:209130705-209130727 CATTTTTCCCATCAGGATGTGGG - Intergenic
921299164 1:213734003-213734025 TCTTTTTTCCATTAGGAAGATGG - Intergenic
922744357 1:228035912-228035934 TATTTAAGCCATGAGGAGGTAGG - Intronic
922794091 1:228330750-228330772 TATTTTTTCCATAAGTTATTGGG + Intronic
924107467 1:240663367-240663389 TTTTTTTCTCATTAGGAGGTTGG + Intergenic
1062782231 10:224025-224047 TATTTTTACCATATGGAATTTGG - Intronic
1062976679 10:1688648-1688670 TATTTTTTGCAGGAGGGGGTTGG - Intronic
1063600769 10:7479383-7479405 TATTTTTTCTATAGGGAGAATGG - Intergenic
1063907237 10:10793827-10793849 TATTTTTTATTTATGGAGGTTGG - Intergenic
1065269065 10:24008132-24008154 TATTTAATCCATAGGAAGGTAGG + Intronic
1065843509 10:29725903-29725925 TATTTTTTAAAAAAGGATGTAGG - Intronic
1066195626 10:33096790-33096812 AATTTTTTCAAGAAGGATGTTGG + Intergenic
1066583674 10:36908627-36908649 TAATTTTTGCATAAGGTGTTAGG + Intergenic
1068211097 10:53921890-53921912 TATCTTTTCCATAAATAGGGAGG - Intronic
1068397531 10:56483699-56483721 TATTAATACCATAAGGTGGTGGG - Intergenic
1069049638 10:63778945-63778967 CAGTTTTTCCATAATGGGGTGGG - Intergenic
1069070798 10:63988835-63988857 TATTTTTGCCAAAAGGGGTTGGG - Intergenic
1069886205 10:71625360-71625382 TGTTTTCTCCATGGGGAGGTGGG - Intronic
1070431056 10:76338059-76338081 TTTTTTTTCTATAAGGAGAAGGG - Intronic
1071105122 10:82085199-82085221 TGTATTTTCCAAAAGGAAGTTGG - Intronic
1071248142 10:83787180-83787202 TATTTTTTCCATATGCTAGTTGG + Intergenic
1071779301 10:88825233-88825255 TACTTTTTCAATAAGGAACTGGG + Intronic
1071996301 10:91153049-91153071 TATTTTTTCCAGAAATAGGGTGG + Intergenic
1072133328 10:92518057-92518079 TTTTTTTTCCCTAAGGAGTTAGG - Intronic
1072446378 10:95502264-95502286 TATTTTTTCCATAAATAGAAAGG - Intronic
1072837587 10:98733072-98733094 TATCTCTTCTATAAGGATGTAGG + Intronic
1073919828 10:108445922-108445944 CATCTGTTCCATGAGGAGGTTGG + Intergenic
1074245618 10:111688385-111688407 TATTTTTTCCATAAGTTATTGGG - Intergenic
1074373716 10:112921789-112921811 TGCTTTTTCCATCAAGAGGTAGG - Intergenic
1074441100 10:113477991-113478013 TATGTATTCCAGGAGGAGGTGGG - Intergenic
1074510042 10:114103248-114103270 TATTTTCTGCATTAGGAGTTTGG + Intergenic
1074959693 10:118431162-118431184 ATTTTTTTCCATATGGAGATTGG + Intergenic
1074967364 10:118503232-118503254 CAATGTTTACATAAGGAGGTGGG - Intergenic
1075428617 10:122362555-122362577 TTTCTTTCCCAGAAGGAGGTTGG + Intergenic
1077752092 11:4983510-4983532 CATTTCTTCCAGAAGGAGATGGG + Intronic
1077876173 11:6308806-6308828 AATTTTTACCATAAAGAGTTAGG - Intergenic
1077977233 11:7260647-7260669 TATATTTTCCATAAGGAACCAGG - Intronic
1078203743 11:9209627-9209649 TATTTTCTCCATAAGGGGAAAGG + Intronic
1079347072 11:19662464-19662486 TATTCTTTCCCTGAGGAGGCAGG - Intronic
1079784817 11:24658399-24658421 TAATTTTTCTATAAGGTGTTAGG - Intronic
1080463558 11:32476285-32476307 TACCTTTTCCATATTGAGGTAGG - Intergenic
1082125165 11:48423976-48423998 TTTTTTTTCCATAAGTTAGTGGG + Intergenic
1082558834 11:54595245-54595267 TTTTTTTTCCATAAGGTATTGGG + Intergenic
1082943527 11:58733972-58733994 TATTTTTTCCCTAAGGTTCTAGG + Intergenic
1083248293 11:61447324-61447346 TATTTTATACATAAGAAAGTGGG + Exonic
1087875374 11:103349419-103349441 TATTTTTACTATCAGTAGGTAGG + Intronic
1087928668 11:103950236-103950258 TATTGTTTAAATAAGGAGATTGG - Intronic
1088060894 11:105648243-105648265 TATTTTTTCCAAAAGGAAGTAGG + Intronic
1089060713 11:115623805-115623827 TGTTTTTTCCCTAAGCAGTTGGG + Intergenic
1089079505 11:115764056-115764078 TTTTCTTTCCTGAAGGAGGTTGG - Intergenic
1092123313 12:6059201-6059223 TAAATTTTAAATAAGGAGGTGGG - Intronic
1092663845 12:10772141-10772163 TATTGATTTCATAAGGTGGTGGG + Intergenic
1097565207 12:61260271-61260293 CATTTTTTATATAAGTAGGTGGG - Intergenic
1099436900 12:82656776-82656798 TATTTTTGCCCTAAAGAGGTGGG + Intergenic
1099452614 12:82825587-82825609 TATTATTTCCACAATGTGGTAGG + Intronic
1099513276 12:83564553-83564575 TGTTTTTTTCTTAAGGAGATGGG + Intergenic
1099815804 12:87646030-87646052 TATTTTTTTACTGAGGAGGTAGG - Intergenic
1100099509 12:91086476-91086498 TTTTTTTTCCGTAAGTATGTTGG + Intergenic
1101208204 12:102510120-102510142 TATTTGTTCCTTAAAGAGGGAGG - Intergenic
1102838188 12:116087729-116087751 TTTTTTTTGCAGAATGAGGTAGG - Intronic
1103035374 12:117652293-117652315 TATTTTTTCCATAAGTTATTGGG - Intronic
1103456133 12:121067216-121067238 TCTTTTTTCCAAACGGAGTTTGG - Intergenic
1103824688 12:123728256-123728278 TCTTTTTTTCTTAAGGAGATGGG + Intronic
1106596178 13:31140741-31140763 TGGTTTTTCCATACTGAGGTGGG - Intronic
1107117619 13:36763826-36763848 TCTCTTTACCATAAGCAGGTAGG - Intergenic
1107299639 13:38951570-38951592 TTTTATTTCTATAAAGAGGTGGG - Intergenic
1109213102 13:59557554-59557576 TATTTTTTCCATAAGTTATTGGG + Intergenic
1109418752 13:62080584-62080606 CATTTTCTTCACAAGGAGGTAGG - Intergenic
1109529843 13:63627672-63627694 TGTTTTTTACATAAAGAGGAAGG - Intergenic
1109880923 13:68475297-68475319 TTTTTTTTCCCAAAGGATGTTGG + Intergenic
1109966825 13:69710817-69710839 TGTTTTTTTAATAAGGTGGTGGG + Intronic
1110401318 13:75095568-75095590 TCTTTTTTCCAGGAGGGGGTGGG - Intergenic
1111287459 13:86113624-86113646 TATTTTTTCCCCAAGAAGTTTGG + Intergenic
1111497605 13:89072711-89072733 TATTTTTTCCATAAGTTATTGGG + Intergenic
1111652334 13:91107694-91107716 TATTTCTTGCTTAAGGAAGTTGG + Intergenic
1111883390 13:93987805-93987827 TGTTTTTTGCATAAAGAGATAGG + Intronic
1112114783 13:96339902-96339924 AATTATTTCCAGAAGGAGGTGGG + Intronic
1112377425 13:98856126-98856148 TATTTTTTCTGTTAGGAAGTTGG + Intronic
1113562801 13:111296560-111296582 TCTTATTTCCGTATGGAGGTGGG - Intronic
1114788145 14:25624859-25624881 TATTTCTTCCCTCAGGAGGAAGG + Intergenic
1114791554 14:25665052-25665074 CATTCTTTCCATCAAGAGGTGGG - Intergenic
1115605115 14:34993378-34993400 GATCTTTTCCATGAGGTGGTTGG + Intronic
1115675203 14:35665906-35665928 TATTATCTGCTTAAGGAGGTGGG + Intronic
1117400199 14:55352126-55352148 GATTTTTACCATAATGTGGTGGG - Exonic
1117949380 14:61066198-61066220 TATTTTTTCCATAAGGAGGTAGG + Intronic
1118155518 14:63237245-63237267 TATTTTTTTAAGAAGGAGCTTGG + Intronic
1119675060 14:76547342-76547364 TATTTGTTCCATAAAAGGGTAGG - Intergenic
1119823885 14:77641451-77641473 TCTTTTTTTTATAATGAGGTAGG - Intergenic
1120176023 14:81294221-81294243 GATTCTTTCCACAAGGAGATAGG + Intronic
1121178771 14:91911536-91911558 TATTTTTTCTTTTAGGAGGTGGG - Intronic
1121938194 14:98040405-98040427 AATTTTTTACATAAGGAGAAAGG + Intergenic
1126782721 15:52152239-52152261 CAGTTTTTCCAAAAGCAGGTTGG - Intronic
1129865869 15:78908141-78908163 TATTTCTTCCAGATGGAGGAAGG + Intergenic
1130074784 15:80679321-80679343 TATTCATTCCAGAAAGAGGTGGG + Intergenic
1130245887 15:82248303-82248325 TATTCTTTCCAGAATGAGGCTGG - Intronic
1130454809 15:84095073-84095095 TATTCTTTCCAGAATGAGGCTGG + Intergenic
1132110472 15:99099061-99099083 TATTATATGGATAAGGAGGTGGG + Intronic
1133842976 16:9427284-9427306 TGTTTTTTCCAAATGGAGATGGG - Intergenic
1134400011 16:13901185-13901207 TACTTTTTCCATAAGTAAGTGGG + Intergenic
1134506419 16:14811263-14811285 TTATTTTTCCATAACAAGGTAGG + Intronic
1134574135 16:15317502-15317524 TTATTTTTCCATAACAAGGTAGG - Intergenic
1134728286 16:16438799-16438821 TTATTTTTCCATAACAAGGTAGG + Intergenic
1134939153 16:18273033-18273055 TTATTTTTCCATAACAAGGTAGG - Intergenic
1135978240 16:27125509-27125531 TATTTTTTTAATAAAGAGATGGG - Intergenic
1137073402 16:35930388-35930410 TTTATTTTCAATAAGCAGGTTGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1139419364 16:66840701-66840723 TATTTTTTCCATAAGTTATTGGG - Intronic
1140288679 16:73629362-73629384 TTTTTTTTCCCTAAGAAGGAGGG - Intergenic
1141938596 16:87258978-87259000 TTTTTTTTCCTTTAAGAGGTGGG + Intronic
1142551005 17:739506-739528 TATTTTTTAAATAAAGAGATGGG + Intronic
1143772198 17:9175848-9175870 GATTTTTTCCATAAAGAGAAAGG - Intronic
1144648050 17:16988646-16988668 TAGTTTTACCCTAAGGAGGTAGG - Intergenic
1146581021 17:34039222-34039244 TATTTTTTCTATTGTGAGGTCGG + Intronic
1147549226 17:41427217-41427239 TATTTTTTCCATAAGTGGTGGGG + Intergenic
1149150446 17:53556272-53556294 TTTTTTTTCCAGAAGAAGGTAGG - Intergenic
1149150461 17:53556667-53556689 TATTTTTTACATAAGTACATTGG + Intergenic
1149499543 17:57141527-57141549 TATTTGTGACATGAGGAGGTAGG + Intergenic
1150116335 17:62553664-62553686 TATTTTTTCTATTGTGAGGTCGG - Exonic
1150601450 17:66654386-66654408 CATTTTTCCCAAAAGGTGGTTGG - Intronic
1151007094 17:70450362-70450384 TATTTTTTGGATAGGGAGCTAGG - Intergenic
1151126178 17:71847083-71847105 TAGATTTTCTTTAAGGAGGTAGG + Intergenic
1151481924 17:74374707-74374729 TATTCTTTGCTTAAGGAGGAGGG + Intergenic
1153531447 18:6050801-6050823 TATTTTTCCCATTATGAGCTGGG - Intronic
1153996400 18:10445727-10445749 CACTTTTTCCATAAGAAGGGAGG - Intergenic
1155834358 18:30560269-30560291 TATATTTTCCATATAGAGCTTGG + Intergenic
1156213545 18:34974115-34974137 CATTTTTTCCATAAGCCTGTTGG - Intergenic
1157520190 18:48340236-48340258 TACTTGTTCCAGAAGGAGGTTGG - Intronic
1158012092 18:52740740-52740762 TATTTTATGGATAATGAGGTAGG + Intronic
1158090797 18:53710820-53710842 CATTTTTTCCAAAAGAAGATGGG - Intergenic
1158099822 18:53818584-53818606 CATTTTTTCCATAAGGACGCAGG - Intergenic
1158399682 18:57110870-57110892 TATTTTTTCCAAGGGGGGGTAGG - Intergenic
1160361401 18:78284936-78284958 TTTTTTTCTCATGAGGAGGTTGG + Intergenic
1161907477 19:7167842-7167864 TATTTATTCCAGGAGGAGGAGGG + Intronic
1163653167 19:18530628-18530650 TTTTTTTTTAATAAAGAGGTGGG - Intergenic
1163760976 19:19136754-19136776 TCTTTTTTCAGTAATGAGGTTGG + Intronic
1164486985 19:28666929-28666951 TTTTGTCCCCATAAGGAGGTAGG + Intergenic
1166787951 19:45380502-45380524 GATTTTTTAAATATGGAGGTGGG - Intronic
1168165056 19:54541447-54541469 TTTTTTTTCCATAAGGAGGGAGG - Intronic
1168535727 19:57167775-57167797 TTTTTTTCCCACAAGGGGGTTGG - Intergenic
925761943 2:7193310-7193332 TATTTTATCCTTAAGGCTGTGGG + Intergenic
926617219 2:15008855-15008877 TATTTTTTAAACAATGAGGTGGG - Intergenic
927822395 2:26279387-26279409 TGATTTTTCCATAAGTATGTTGG + Intronic
928016991 2:27666659-27666681 TTTTTTTTCCACAATGTGGTAGG + Intronic
928272460 2:29868760-29868782 CATTCCTTCCATCAGGAGGTGGG + Intronic
928808115 2:35186781-35186803 TTTTTTTTCCATTTGAAGGTTGG + Intergenic
929172119 2:38942715-38942737 TATTTTTTTTATAAGGAGGGGGG - Intronic
929556509 2:42928928-42928950 CAATTTTTCCCTAAGTAGGTAGG + Intergenic
929728004 2:44452494-44452516 TATTTCTTTAAAAAGGAGGTAGG - Intronic
930136932 2:47911738-47911760 TAATTTTTGCATAAGGTGTTAGG + Intergenic
930147976 2:48026805-48026827 TATTTTTTCTATTAAGAGGTAGG + Intergenic
930340114 2:50101990-50102012 CATTTTTTTCCTAAGGATGTCGG - Intronic
930889201 2:56363106-56363128 TATTTTTTTTATAAGAAGGTAGG + Intronic
931502295 2:62882534-62882556 TCTTTATTCCATCAGGAGTTTGG + Intronic
932803731 2:74765679-74765701 CTTTCTTTCCATTAGGAGGTGGG + Intergenic
933126495 2:78614506-78614528 TATGTTTTCCATGAGGAGTCAGG + Intergenic
933488445 2:82952012-82952034 TATTTTTTACAGAATCAGGTTGG - Intergenic
934125402 2:88883777-88883799 TATATTTTCCATAATAGGGTAGG + Intergenic
935172156 2:100618577-100618599 TAATTTTTCCATAAGTTGTTGGG + Intergenic
935313506 2:101808135-101808157 TATTTTATCCATTAGGAGGATGG + Intronic
935465111 2:103387449-103387471 TATTTTTTAAATAATGAGGCAGG + Intergenic
937676815 2:124600041-124600063 TATTTGTTCCATAATGTGTTAGG + Intronic
938504013 2:131856034-131856056 TATTTTTCTCATAAATAGGTAGG - Intergenic
939969046 2:148639933-148639955 TATTATTTTCATAAGGGTGTTGG - Intergenic
940462480 2:153983856-153983878 TATTTTCTCCAGAAGGAAGAAGG - Intronic
940468476 2:154063055-154063077 TATTTTTTACAGAAGGGTGTTGG + Intronic
940984447 2:160038634-160038656 TCTTTTTGCCATTATGAGGTAGG + Intronic
941311370 2:163936407-163936429 TAGTTTTTTTAAAAGGAGGTTGG + Intergenic
942236232 2:173909242-173909264 TATTCTTTCAATAACGAAGTTGG - Exonic
942777841 2:179606503-179606525 TATTTTTTCCTTTAGGTTGTGGG + Intronic
942852070 2:180499298-180499320 TATTTATTCCTTAAGAAGCTAGG + Intergenic
946501660 2:220254100-220254122 TATTTTTTCCATAAGTTATTGGG - Intergenic
946894908 2:224313638-224313660 TATTTATATCAAAAGGAGGTAGG + Intergenic
947342702 2:229156754-229156776 GAATTTTTCCATGAGGAGATGGG - Intronic
1169587829 20:7106165-7106187 TATTTTTTCCATAAGTTATTGGG + Intergenic
1169981448 20:11389320-11389342 TATTTTTTTCTTAAGGGAGTGGG - Intergenic
1170875557 20:20246801-20246823 AATTTTTCCAATAAGGAGGAAGG + Intronic
1171021819 20:21591416-21591438 TATTTTTTTCATATAGAAGTAGG + Intergenic
1171242163 20:23580370-23580392 TATTTTTTCCATAAGTTATTGGG + Intergenic
1171366460 20:24628144-24628166 TAATTTTTACAAAAGGAAGTAGG - Intronic
1172924307 20:38517239-38517261 TATTTTGACCATAAAGAAGTTGG - Intronic
1173326484 20:42038223-42038245 TATTTTATAAATAAGGAGATCGG + Intergenic
1173339019 20:42137392-42137414 CATCTTTTCCAGAAGGAGGTGGG - Intronic
1173341126 20:42154004-42154026 TCTTTTTTCAATCTGGAGGTGGG + Intronic
1174931480 20:54820950-54820972 TATATTTTCCATAATGAAGTTGG + Intergenic
1177501436 21:21961445-21961467 TATTTTTTTCATATGGTTGTTGG + Intergenic
1177561836 21:22765744-22765766 TACTTTTTCAATAAGGGGATTGG + Intergenic
1177994913 21:28085156-28085178 TATTTTTTCCATAAGCTATTGGG + Intergenic
1178029050 21:28504232-28504254 TACATCTTGCATAAGGAGGTGGG - Intergenic
1178868010 21:36346386-36346408 TATTTTATGCATAAGGAAGTTGG + Intronic
1178906952 21:36644274-36644296 TATTTTTTCCATAAGTTATTGGG + Intergenic
1179452835 21:41477452-41477474 TTTTTTTTCTAGGAGGAGGTTGG - Intronic
950951994 3:17010090-17010112 TATGTTTTCCATAAGAAATTAGG - Exonic
950957611 3:17071133-17071155 CATTTGAACCATAAGGAGGTAGG + Intronic
951420880 3:22483361-22483383 TAATTTTTCTATAAGGAGTAAGG - Intergenic
955099081 3:55829524-55829546 TATTTTTTCTTTAATGAGATGGG + Intronic
955124277 3:56094889-56094911 TATTTTTGTCATAAAGAGTTAGG - Intronic
955596591 3:60597106-60597128 TATTTATTCCATAAGAAAATGGG + Intronic
955823798 3:62923879-62923901 TCTTCTTTCCAAATGGAGGTTGG - Intergenic
956113394 3:65894139-65894161 GATTCTTTCCATAGGGAGGCGGG - Intronic
956712310 3:72049365-72049387 TATTTTTTAAAAAAGGAGTTGGG - Intergenic
956968960 3:74499030-74499052 TATTTTTTTCTTAAGGTGGTGGG + Intronic
957155756 3:76541914-76541936 TATTTTCTCAAGAAGGAAGTGGG - Intronic
957695333 3:83630101-83630123 TACTATTTCCATAGAGAGGTTGG + Intergenic
958032700 3:88132086-88132108 TATTATTTCCATAAGCTTGTTGG - Intronic
960512301 3:118565502-118565524 TTTTTTTTCCATAAGTTGTTGGG + Intergenic
960633120 3:119753667-119753689 TATTTTTTCCATAAGTTATTGGG + Intronic
962128264 3:132645708-132645730 TGTTTTTTCCTGATGGAGGTTGG - Intronic
965237326 3:166142175-166142197 AATTTTTTCCATCAAGAAGTTGG + Intergenic
966450877 3:180060031-180060053 TATTTATTCAATAAGTAAGTGGG - Intergenic
970168242 4:13262573-13262595 TATTTTATAAGTAAGGAGGTAGG - Intergenic
970934128 4:21548876-21548898 TATTTTTTCCATACAGAGCAGGG + Intronic
971176846 4:24290226-24290248 TATTTTTTCCATAGGTTGTTGGG + Intergenic
971869193 4:32214415-32214437 TATTTTGTCCTTAGGGAGGTAGG - Intergenic
972013912 4:34220049-34220071 TATTTTTTCCATAAGTTACTGGG - Intergenic
972463798 4:39332475-39332497 TATGTATTGAATAAGGAGGTAGG - Intronic
972526112 4:39913461-39913483 AATTTATTCCATAAGAAGGATGG + Intronic
972795587 4:42414909-42414931 CATTTTCTCCCTAAGGAGTTTGG + Intronic
972943365 4:44224192-44224214 TATTTTATTCATAAGGCAGTAGG - Intronic
973755043 4:54065841-54065863 AGTTGTTTCCAAAAGGAGGTTGG - Intronic
973875196 4:55210751-55210773 TAATTTTTCTATAAGAAGGAAGG - Intergenic
974543288 4:63267139-63267161 TAATTTTTGTATAAGGAGGAAGG - Intergenic
974915775 4:68176300-68176322 TATATTTTCCATAATGAGCATGG - Intergenic
974971065 4:68828002-68828024 AATTTTTGCCATAAATAGGTGGG - Intronic
975078539 4:70245279-70245301 TTTTGTTTCCATAAAGAGATTGG - Intronic
975400582 4:73932642-73932664 TACTTATTACATAACGAGGTAGG - Intergenic
977467282 4:97398492-97398514 TAATTTTTCCATAAGGTGTATGG + Intronic
977708508 4:100098067-100098089 GCTTTTTTCTATCAGGAGGTGGG + Intergenic
978353827 4:107849026-107849048 TTTTTTTTACATATGGAAGTCGG + Intronic
978948919 4:114533424-114533446 TATTTTTCCCATTAGTAGGTTGG - Intergenic
979382916 4:120029734-120029756 AATGTTTTCCTTAAGTAGGTAGG + Intergenic
979435574 4:120685222-120685244 AATTTTGTTAATAAGGAGGTAGG + Intronic
979514901 4:121596401-121596423 TATTTATTTCATATCGAGGTAGG - Intergenic
979701898 4:123678260-123678282 TATTTTTTTCATAAAGATCTTGG - Intergenic
980704728 4:136478576-136478598 TTTTTTTTCTTTAAAGAGGTGGG + Intergenic
981967612 4:150624297-150624319 TTTTTTTTTGATAGGGAGGTAGG - Intronic
982051593 4:151507739-151507761 TGTTTAAACCATAAGGAGGTGGG - Intronic
982434902 4:155373884-155373906 TATTTTTTCCATAAAAATTTTGG + Intronic
982622547 4:157725593-157725615 TATTTTTCCCTTAGGGATGTTGG - Intergenic
983165003 4:164464719-164464741 TAGTGTTTCCATAAGAAGATGGG - Intergenic
983376853 4:166940750-166940772 TACATTCTTCATAAGGAGGTGGG + Intronic
983376857 4:166940847-166940869 TACGTTCTTCATAAGGAGGTGGG - Intronic
984379522 4:178972861-178972883 TTTTCTATCCATAAGGAGGAAGG - Intergenic
985043191 4:185913261-185913283 TATTTGTTCCATAAAAAGATAGG - Intronic
985422771 4:189801260-189801282 CATTTTTTCCATCGGGAGGTGGG + Intergenic
985843973 5:2330409-2330431 GATTTTTTCCATAAACAGCTGGG + Intergenic
990266302 5:54080444-54080466 TATTTTTTACATAAGCATTTAGG + Intronic
990554144 5:56913223-56913245 TATTTTTTATATAAAGAGATGGG + Intronic
991519194 5:67476543-67476565 TTTTTATTCCATAAGAATGTTGG - Intergenic
992523829 5:77585953-77585975 TATTTTTTCCATAAGTTATTGGG - Intronic
994012945 5:94928833-94928855 TATTTTTTCTTTTTGGAGGTGGG - Intronic
994380365 5:99063662-99063684 TATTTTTTCCAGAAGCAGAGGGG + Intergenic
994558616 5:101337099-101337121 TTTTTTTTCCAAAAGTAGATGGG - Intergenic
995549503 5:113266778-113266800 TTTTTTGTCCATATGGAGGGAGG - Intronic
995674903 5:114652426-114652448 TCTTTTTTCCATATGGAGAGGGG - Intergenic
996080655 5:119255103-119255125 TCTCCTTTCAATAAGGAGGTAGG + Intergenic
996409236 5:123139060-123139082 TACTTTTTTCACAAGGAGGCAGG - Intronic
996766671 5:127041210-127041232 TATGTTTTCCATTAGAAGGAGGG + Intergenic
997866827 5:137471235-137471257 TATTTTTTACATAATTAGATTGG + Intronic
999690987 5:154145693-154145715 TATTATTCCCATGAGAAGGTAGG + Intronic
1000120966 5:158197515-158197537 TTTTTTTTTCACAAAGAGGTGGG + Intergenic
1000260118 5:159580000-159580022 TATTTTTTCCATAAGTTATTTGG - Intergenic
1000261523 5:159593073-159593095 TTTTTTTTCCCTAAGGAGCCTGG + Intergenic
1000801971 5:165739126-165739148 TTTTTTTTTCCTGAGGAGGTTGG + Intergenic
1002069289 5:176669869-176669891 CATTTTATGCATAAGGAGCTGGG + Intergenic
1002688149 5:181031748-181031770 TAATTTTTTCAAAAGGAGTTAGG + Intergenic
1004035552 6:11919522-11919544 TATTTTTCCCTTAAGGACGCTGG - Intergenic
1004919797 6:20365916-20365938 TTTTTATTTCATAAGGAGTTGGG + Intergenic
1005085311 6:22000274-22000296 TATTTCTGATATAAGGAGGTAGG - Intergenic
1006832519 6:36977446-36977468 AATTCTTTCCAAAGGGAGGTGGG - Intronic
1009341481 6:62559978-62560000 TAATTTCTCCATAAGGGAGTAGG - Intergenic
1009372203 6:62919437-62919459 TTTTTTTTCCATAAGGACAGTGG - Intergenic
1010493592 6:76504402-76504424 TATTTTTTGCATAAGGTGTAAGG + Intergenic
1011656346 6:89555431-89555453 TATTTTATACATAAGGGAGTGGG + Intronic
1011936746 6:92788421-92788443 TATTTCTTCAATAAGCAGATTGG - Intergenic
1012422967 6:99084795-99084817 TATTTTTTCTTTGAGGAGCTGGG + Intergenic
1012914550 6:105155514-105155536 TATTTTTACTATAAGGAGAAAGG - Intergenic
1014066967 6:117138247-117138269 TATTTTTTATTTAGGGAGGTTGG - Intergenic
1014259317 6:119197805-119197827 TTTTTTTTCCATCAGGAAATTGG + Intronic
1014477603 6:121892541-121892563 TATTTCTACCATAAGCAGTTGGG + Intergenic
1014530954 6:122558758-122558780 TATTTTTTCCATAAGTTATTGGG + Intronic
1015048323 6:128806608-128806630 TAATCTTTCCATCAGGAGGCAGG + Intergenic
1015328114 6:131948168-131948190 TATTTTTTCTATAAAGGGCTTGG - Exonic
1015775643 6:136811465-136811487 TGTTTTTTCCAAAAGGAGCTGGG - Intergenic
1015987169 6:138896100-138896122 TTTTTTTTCCTTAATGAGATGGG + Intronic
1016429290 6:143965595-143965617 TATTTTAGTTATAAGGAGGTGGG + Exonic
1016599150 6:145837142-145837164 TATTTTTTCCCTAACAATGTTGG - Intergenic
1017437709 6:154432925-154432947 TATATTTTCCATAAATAGGGAGG - Intronic
1017632992 6:156416923-156416945 TATTTTTTCCATAAGATTATAGG - Intergenic
1018262803 6:161987342-161987364 TATATTTTACATAAGTAGGATGG - Intronic
1020171249 7:5846754-5846776 TATTTTTTCTAGAAGAAGTTTGG + Intergenic
1020407966 7:7858088-7858110 TAATTTTTCCTTTATGAGGTAGG - Intronic
1020907242 7:14078606-14078628 TCTTTTTTGCATAGGGAGTTGGG - Intergenic
1021500392 7:21326607-21326629 TATTTTTTCTTTTAGGAGTTGGG - Intergenic
1021822263 7:24509966-24509988 TATTTTTTCCATGATTAAGTTGG + Intergenic
1021898994 7:25264414-25264436 TATTTTATCCAGAAGAAGGGGGG + Intergenic
1022326883 7:29340659-29340681 TATTTTCTCCCTGGGGAGGTGGG - Intronic
1022578392 7:31521995-31522017 TTTTTTTCCCATAAAGAGCTTGG - Intronic
1023134318 7:37036199-37036221 TTTTTTTTCAATAAATAGGTTGG - Intronic
1023153416 7:37223812-37223834 TATTATTTTCATTTGGAGGTGGG - Intronic
1024353838 7:48394698-48394720 TATTTTTTCCATAAGTTATTGGG + Intronic
1025068806 7:55880825-55880847 TAATTATTCCATATGGATGTAGG + Intergenic
1025534732 7:61933671-61933693 TATCTTTTCAATCAGTAGGTTGG + Intergenic
1026199706 7:68203843-68203865 TTTCTTTTCCATTAGGAGGCAGG + Intergenic
1027549187 7:79569178-79569200 TAATTTTTCCATAAGTAGTGTGG - Intergenic
1027672075 7:81113661-81113683 TTTTTTTTCCACAAAGAGATGGG + Intergenic
1027690384 7:81337626-81337648 TATTTTTTCCTTTTGGAGATAGG + Intergenic
1027737212 7:81948449-81948471 TTTTTTTTCAATAAAAAGGTGGG - Exonic
1027817585 7:82996569-82996591 TATTTTATTCATAAGGAAGGAGG - Intronic
1027981935 7:85235784-85235806 TGTTTTCTCCATAAGTAGGAAGG + Intergenic
1028905324 7:96147857-96147879 TATTTCTTCCACATGGTGGTAGG - Intronic
1029579909 7:101429291-101429313 TATTTTTTGCATAAGGTGTGAGG + Intronic
1029677143 7:102077618-102077640 TATTTTTTTCTTAAAGAGATGGG - Intronic
1029812924 7:103067385-103067407 TATTTCTTACATAAAGAGGTGGG + Intronic
1030420075 7:109298447-109298469 TACTTTGTCCTTAAGGAAGTGGG - Intergenic
1031234646 7:119159179-119159201 TATTTTTTCCATAAGTTATTGGG + Intergenic
1032046067 7:128609488-128609510 TATTTTTTCTATTGTGAGGTTGG - Intergenic
1032498916 7:132385037-132385059 TCTTTTTTCCCTAAGGACTTGGG + Intronic
1032673965 7:134111110-134111132 TATTTCTTCCACATGCAGGTGGG + Intergenic
1032676726 7:134136296-134136318 GATCATTTCCATAAGGAGGTTGG - Intronic
1032803265 7:135333494-135333516 TTCTTTGTCCATAAAGAGGTAGG + Intergenic
1033150085 7:138906787-138906809 TTATTTTTCCATAAGGCGTTGGG - Intronic
1033153870 7:138939809-138939831 CATTATTTCACTAAGGAGGTTGG + Intronic
1034391578 7:150791613-150791635 TTTTTTTTCCAGAATGAGGAAGG - Exonic
1035923141 8:3700240-3700262 TATTTTTTCCATAAGTTATTGGG - Intronic
1038196896 8:25376568-25376590 TAATTTTTCCATATGGACTTTGG + Intronic
1038943620 8:32332844-32332866 AATTTTTACCATAAGAAGTTGGG - Intronic
1039093791 8:33860932-33860954 TATTATTCCTATAAGGAGTTAGG + Intergenic
1039109904 8:34030298-34030320 TTGCTTTTACATAAGGAGGTGGG + Intergenic
1039722839 8:40183140-40183162 TTCTTTTTGCATAAGGTGGTGGG - Intergenic
1039791735 8:40881785-40881807 TATTTTTTCCATACAGAGATGGG + Intronic
1039937582 8:42059901-42059923 TATTTGTTCCATAAGCATTTTGG - Intergenic
1040129661 8:43780210-43780232 TGTTTTTTGCATCAGCAGGTTGG + Intergenic
1040478250 8:47799886-47799908 GATTTGTTCCATAAGCTGGTGGG + Intronic
1040736997 8:50520265-50520287 TATTTTTTGTATAAGGTGTTAGG - Intronic
1040958681 8:53007211-53007233 TCTTTAATTCATAAGGAGGTGGG + Intergenic
1042616434 8:70654893-70654915 TATTTTTTCCATAAGTTATTGGG + Intronic
1043199783 8:77352461-77352483 TACTTTTTTCCTAAGGATGTAGG + Intergenic
1043614156 8:82104656-82104678 TATTTTTTCCTTAAGGAATAAGG + Intergenic
1043708995 8:83390401-83390423 TATTTTTTCCATAATTAGCTTGG - Intergenic
1044173189 8:89082333-89082355 TTTTTTTGGCATAAGCAGGTGGG - Intergenic
1045031332 8:98139279-98139301 TATTTTTTCCACATGGAACTAGG - Intronic
1045130443 8:99146213-99146235 AATTTTTTACATAAGGAGTGAGG + Intronic
1045268365 8:100640703-100640725 TATTTTTTACATAATTAGATGGG - Intronic
1045547994 8:103145198-103145220 TATCTTTTCCCTAAGGAAGGAGG + Intronic
1046303463 8:112329423-112329445 TATTTTTTCTAGAAGGTGGGGGG - Intronic
1047245718 8:123142383-123142405 TCTGTTTTCCCTAAGGAGTTTGG - Exonic
1051696215 9:19770609-19770631 AATTTTCTCCATCAGGAAGTGGG - Intronic
1051878618 9:21817179-21817201 TGTTGTTTCCTTAAGGAGGCTGG + Intronic
1052010911 9:23407987-23408009 TATTTTTTCCATGAGAAACTGGG + Intergenic
1052631649 9:31048836-31048858 TATTTTTTCCCTTGGGAGGTGGG - Intergenic
1053207189 9:36196519-36196541 TATTTTTAGTATATGGAGGTGGG + Intronic
1054981064 9:71206752-71206774 TAATTTTTGCATAAGGAGTAAGG + Intronic
1055136535 9:72835571-72835593 TATTTTTTCCATAATGTGTATGG + Intronic
1056237643 9:84611005-84611027 CATTCTTCCCATAAAGAGGTAGG - Intergenic
1057679156 9:97160351-97160373 TTCTTTCTCCATAAGGAGCTTGG + Intergenic
1057817086 9:98303746-98303768 TATTTTTTCCACAAGGAGCAAGG - Intronic
1058587374 9:106524694-106524716 CATTTTTTCCATAAGTTTGTTGG - Intergenic
1058720954 9:107763265-107763287 TATTTTTTCCATAAGTTATTGGG + Intergenic
1059870584 9:118569562-118569584 TATCTTTTCCATGAAGAGATAGG - Intergenic
1060236703 9:121868848-121868870 TATTATTTCCATCAGGCAGTGGG - Intronic
1060465029 9:123896124-123896146 TATTTTTTCCTGATGGAGCTGGG - Intronic
1060603897 9:124897170-124897192 TCTCTTTTCCATATGGAGTTAGG - Intronic
1185949209 X:4412357-4412379 TGTTTTCTCCGTAAGGAGGCTGG - Intergenic
1186084197 X:5968836-5968858 TATTTCTTCCATAATTAGCTTGG + Intronic
1186092026 X:6060259-6060281 TGTTATTTCCATAATGAGGATGG + Intronic
1187298294 X:18024006-18024028 TATTTATTTAACAAGGAGGTGGG - Intergenic
1187497787 X:19811076-19811098 TATTTTTTTAATAAGCAGATTGG + Intronic
1187530062 X:20088261-20088283 TATTTTATTCACAAGAAGGTTGG + Intronic
1187637673 X:21249900-21249922 TATTTTTTCCAAAAGAATATGGG - Intergenic
1187834060 X:23412757-23412779 TATTTTTTTCATAAGGTGCTTGG + Intergenic
1190089291 X:47423726-47423748 AATTTTTTTCTTAATGAGGTGGG - Intergenic
1190479816 X:50865019-50865041 TATGTTTGATATAAGGAGGTGGG - Intergenic
1191647735 X:63501291-63501313 CATTTTTTCCATATGCAAGTTGG - Intergenic
1192947136 X:75976502-75976524 TATTTTTTCCATAAGTTATTAGG + Intergenic
1193666103 X:84319347-84319369 TATTTTTTACATATGTAGATAGG - Exonic
1194073996 X:89365299-89365321 TACTCTTCCCACAAGGAGGTGGG - Intergenic
1194287274 X:92025436-92025458 TCTTTTTTTCATAAGGTTGTTGG - Intronic
1194667254 X:96688939-96688961 TTTTTTTTCCTTAAAGAGATGGG - Intronic
1195130716 X:101848447-101848469 TATTTTTTCCATTATGAGGAAGG - Intronic
1196355783 X:114790513-114790535 TATTTTTGCTGTAATGAGGTGGG - Intronic
1198063067 X:133066697-133066719 TAATTTTTGCATAAGGTGGAAGG - Intronic
1198831370 X:140754299-140754321 AATTTTTTCCATAAGGCCATGGG + Intergenic
1199215131 X:145253844-145253866 AATTTCTTGCAGAAGGAGGTAGG + Intronic
1200604811 Y:5250002-5250024 TCTTTTTTTCATAAGGTTGTTGG - Intronic
1200729385 Y:6716852-6716874 TACTGTTCCCACAAGGAGGTGGG - Intergenic
1201075333 Y:10182411-10182433 TATTTTTTGCACCAGAAGGTGGG - Intergenic