ID: 1117959970

View in Genome Browser
Species Human (GRCh38)
Location 14:61153177-61153199
Sequence ATGACTCAGAGGACATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117959970_1117959976 26 Left 1117959970 14:61153177-61153199 CCAGAAAATGTCCTCTGAGTCAT No data
Right 1117959976 14:61153226-61153248 AAGGAGAGTAATGAAAGGTTTGG No data
1117959970_1117959977 30 Left 1117959970 14:61153177-61153199 CCAGAAAATGTCCTCTGAGTCAT No data
Right 1117959977 14:61153230-61153252 AGAGTAATGAAAGGTTTGGTAGG No data
1117959970_1117959975 21 Left 1117959970 14:61153177-61153199 CCAGAAAATGTCCTCTGAGTCAT No data
Right 1117959975 14:61153221-61153243 AATTGAAGGAGAGTAATGAAAGG No data
1117959970_1117959974 7 Left 1117959970 14:61153177-61153199 CCAGAAAATGTCCTCTGAGTCAT No data
Right 1117959974 14:61153207-61153229 GATGGAAGAAGGATAATTGAAGG No data
1117959970_1117959973 -4 Left 1117959970 14:61153177-61153199 CCAGAAAATGTCCTCTGAGTCAT No data
Right 1117959973 14:61153196-61153218 TCATGCAATTTGATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117959970 Original CRISPR ATGACTCAGAGGACATTTTC TGG (reversed) Intergenic
No off target data available for this crispr