ID: 1117959971

View in Genome Browser
Species Human (GRCh38)
Location 14:61153188-61153210
Sequence CATCAAATTGCATGACTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117959971_1117959976 15 Left 1117959971 14:61153188-61153210 CCTCTGAGTCATGCAATTTGATG No data
Right 1117959976 14:61153226-61153248 AAGGAGAGTAATGAAAGGTTTGG No data
1117959971_1117959977 19 Left 1117959971 14:61153188-61153210 CCTCTGAGTCATGCAATTTGATG No data
Right 1117959977 14:61153230-61153252 AGAGTAATGAAAGGTTTGGTAGG No data
1117959971_1117959975 10 Left 1117959971 14:61153188-61153210 CCTCTGAGTCATGCAATTTGATG No data
Right 1117959975 14:61153221-61153243 AATTGAAGGAGAGTAATGAAAGG No data
1117959971_1117959974 -4 Left 1117959971 14:61153188-61153210 CCTCTGAGTCATGCAATTTGATG No data
Right 1117959974 14:61153207-61153229 GATGGAAGAAGGATAATTGAAGG No data
1117959971_1117959978 30 Left 1117959971 14:61153188-61153210 CCTCTGAGTCATGCAATTTGATG No data
Right 1117959978 14:61153241-61153263 AGGTTTGGTAGGAAAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117959971 Original CRISPR CATCAAATTGCATGACTCAG AGG (reversed) Intergenic
No off target data available for this crispr