ID: 1117959977

View in Genome Browser
Species Human (GRCh38)
Location 14:61153230-61153252
Sequence AGAGTAATGAAAGGTTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117959970_1117959977 30 Left 1117959970 14:61153177-61153199 CCAGAAAATGTCCTCTGAGTCAT No data
Right 1117959977 14:61153230-61153252 AGAGTAATGAAAGGTTTGGTAGG No data
1117959971_1117959977 19 Left 1117959971 14:61153188-61153210 CCTCTGAGTCATGCAATTTGATG No data
Right 1117959977 14:61153230-61153252 AGAGTAATGAAAGGTTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117959977 Original CRISPR AGAGTAATGAAAGGTTTGGT AGG Intergenic
No off target data available for this crispr