ID: 1117962671

View in Genome Browser
Species Human (GRCh38)
Location 14:61178591-61178613
Sequence GGCAGCCACAGTTGCTGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117962666_1117962671 12 Left 1117962666 14:61178556-61178578 CCGTGGGTTGTGTCTCTCATTCC No data
Right 1117962671 14:61178591-61178613 GGCAGCCACAGTTGCTGGAGCGG No data
1117962662_1117962671 29 Left 1117962662 14:61178539-61178561 CCTGTGCTGAAACCTGGCCGTGG No data
Right 1117962671 14:61178591-61178613 GGCAGCCACAGTTGCTGGAGCGG No data
1117962668_1117962671 -9 Left 1117962668 14:61178577-61178599 CCTCCATCAGCAGTGGCAGCCAC No data
Right 1117962671 14:61178591-61178613 GGCAGCCACAGTTGCTGGAGCGG No data
1117962665_1117962671 17 Left 1117962665 14:61178551-61178573 CCTGGCCGTGGGTTGTGTCTCTC No data
Right 1117962671 14:61178591-61178613 GGCAGCCACAGTTGCTGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117962671 Original CRISPR GGCAGCCACAGTTGCTGGAG CGG Intergenic