ID: 1117976503

View in Genome Browser
Species Human (GRCh38)
Location 14:61302369-61302391
Sequence CTTTCCCCCAACCCGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117976503_1117976508 5 Left 1117976503 14:61302369-61302391 CCTGGGTCCGGGTTGGGGGAAAG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 1117976508 14:61302397-61302419 GGATCCACCATCTCATCTCATGG 0: 1
1: 2
2: 4
3: 20
4: 144
1117976503_1117976511 20 Left 1117976503 14:61302369-61302391 CCTGGGTCCGGGTTGGGGGAAAG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 1117976511 14:61302412-61302434 TCTCATGGCTGCCCTAGACATGG 0: 1
1: 0
2: 1
3: 18
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117976503 Original CRISPR CTTTCCCCCAACCCGGACCC AGG (reversed) Intronic
900633437 1:3650887-3650909 CTCACCCCCACTCCGGACCCCGG + Intronic
900659842 1:3776907-3776929 CATTCCCCCCACCCCGATCCTGG + Intergenic
901654819 1:10763160-10763182 CTTTCCCACAGCCCAGGCCCCGG + Intronic
903020775 1:20392354-20392376 ATTTCCCCCAACCCAACCCCAGG + Intergenic
907239738 1:53074801-53074823 GTCTCCCCCACCCCCGACCCAGG - Intronic
908318431 1:62957669-62957691 ATTTCCCCCAACTCTGACCTAGG - Intergenic
910005460 1:82390841-82390863 CTTTCCCCCAACCCCTCCGCAGG - Intergenic
912313445 1:108645833-108645855 CTTTCCCCCAACCTGGATACAGG - Intergenic
912550649 1:110483322-110483344 CTTCCTCCCACCCAGGACCCAGG + Intergenic
912870833 1:113303924-113303946 CTTTCCCCCTCCCCAAACCCTGG - Intergenic
914713502 1:150235597-150235619 CATTTCCCCAACCCTAACCCGGG + Intronic
915194430 1:154178861-154178883 CTTTCCCCAATCCCTCACCCAGG - Intronic
915463345 1:156082222-156082244 CTTTCCCCCCACCCCCACCCCGG - Intergenic
915626148 1:157115205-157115227 CCTTCCCCCAACACCAACCCAGG + Intergenic
919846674 1:201647291-201647313 CTTTCCTCCTAACTGGACCCAGG - Intronic
922581832 1:226703786-226703808 CTTTCTCCCAAGCCGGAAGCTGG - Intronic
924310319 1:242734668-242734690 CCTTCCCCCAACCCTAACCTCGG - Intergenic
924820234 1:247482440-247482462 CTATCCCCCAGCCCTAACCCTGG + Intergenic
924897376 1:248356042-248356064 CTTTCCCCCAACCCCCTACCTGG - Intergenic
1063997906 10:11638337-11638359 CTTTCTCCCATCCCTGAACCTGG + Intergenic
1067492684 10:46726691-46726713 CTTCCCCCCAACCCTGTCCATGG + Intergenic
1067601982 10:47613704-47613726 CTTCCCCCCAACCCTGTCCATGG - Intergenic
1067781273 10:49209209-49209231 CTTTCCCCCAACCCCACTCCTGG + Intergenic
1068923641 10:62512198-62512220 CTATCCCCCAACACTGACCAGGG - Intronic
1069753177 10:70757906-70757928 CTCTCCACCTACCCTGACCCCGG + Intronic
1071448943 10:85776474-85776496 CTCTGCCCCAGCCAGGACCCTGG - Intronic
1071653511 10:87421292-87421314 CTTCCCCCCAACCCTGTCCATGG - Intergenic
1076527083 10:131118675-131118697 CTGACCCCCAACCCTGACCGTGG + Intronic
1076723994 10:132404963-132404985 CTGTCCCGCAACCGCGACCCGGG + Exonic
1082791263 11:57348075-57348097 CTTCCCCCCATCAGGGACCCTGG - Intronic
1083303686 11:61752361-61752383 CTTCGCCCCCACCCCGACCCGGG + Intergenic
1083714663 11:64568505-64568527 CTGTCCCCCAACCCCAGCCCTGG + Intronic
1084128134 11:67114544-67114566 CTCTCCCCGACCCCCGACCCTGG - Intergenic
1085471816 11:76763376-76763398 TTCTCCACCAGCCCGGACCCAGG + Intergenic
1085784604 11:79439121-79439143 CTTCCCCCCACCCCCCACCCCGG + Intronic
1085990620 11:81839032-81839054 CGTTCCCCCAAACCTGACCCAGG + Intergenic
1086455517 11:86955624-86955646 CTTTCCTCCCACCCGGATCTAGG + Intergenic
1090385466 11:126355649-126355671 CCCGCCCCCAACCCGGGCCCGGG + Intronic
1091239654 11:134043933-134043955 GCTTCCCCCAACCTGGGCCCTGG - Intergenic
1091343892 11:134839947-134839969 GTTTCCCCCAAGCCAGCCCCTGG + Intergenic
1092455567 12:8639598-8639620 TGTTACCCCAACCCAGACCCAGG - Intronic
1099960467 12:89392163-89392185 CCTTCCTCCACCCCTGACCCTGG - Intergenic
1100239271 12:92694546-92694568 CCTTCCCCCAACACAGAACCAGG - Intergenic
1101649078 12:106658596-106658618 CTGTCTCCCAACCCCAACCCTGG - Intronic
1101819141 12:108169737-108169759 CATTCCTCCAACCATGACCCTGG - Intronic
1102375693 12:112419230-112419252 CCGGCCCCCAACCCCGACCCGGG - Intronic
1111978607 13:94993870-94993892 CTATCCCCCACCCCATACCCAGG + Intergenic
1112462918 13:99618713-99618735 CCTTCCCCCCACCCAGCCCCTGG + Intronic
1114390226 14:22300115-22300137 CTTTCCTCCAACTCTTACCCGGG + Intergenic
1117976503 14:61302369-61302391 CTTTCCCCCAACCCGGACCCAGG - Intronic
1118035533 14:61862274-61862296 CTCTCCCACCTCCCGGACCCTGG + Intergenic
1118353063 14:64987681-64987703 CTGTCCCCCAACCAGGCTCCTGG - Intronic
1118772691 14:68952684-68952706 CTTTCCCCCACCCCCTACCTTGG + Intronic
1118846180 14:69549323-69549345 CCTCCCCCCACCCCAGACCCAGG - Intergenic
1122782818 14:104150779-104150801 CTTTCCCACCACCCGAAACCTGG - Intronic
1123684433 15:22786943-22786965 CCTTCCCCCAACCTGGGCCCGGG - Intronic
1126697378 15:51337981-51338003 CTTTCCACCAACCCAGCCCACGG + Intronic
1128315105 15:66655116-66655138 CTCTCCCCCCACCCGGCTCCCGG + Intronic
1128514829 15:68335659-68335681 CTTCCCTCCATCCCGGCCCCAGG + Intronic
1129026826 15:72584051-72584073 CTTTATCCCAACCCCAACCCGGG - Exonic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131060972 15:89404569-89404591 CTTTTCTCCATCCCGGAGCCAGG + Intergenic
1131178513 15:90224854-90224876 CTGTCCCCCCGCCCGGAGCCAGG - Intronic
1131837999 15:96409469-96409491 CTTCCCCCGACCCCGGACCCGGG + Intergenic
1132039098 15:98509905-98509927 CCTCCCCCCACCCCAGACCCCGG - Intronic
1132150754 15:99456494-99456516 CTATCCCCCTACCCGCCCCCCGG + Intergenic
1132712827 16:1276909-1276931 CTGGCCCCCACCCCTGACCCCGG - Intergenic
1133006172 16:2883040-2883062 CTCGCCCGCAACCCGGATCCAGG + Intergenic
1133845471 16:9449302-9449324 CTTTCCTCCACCCCCAACCCTGG - Intergenic
1134867186 16:17618967-17618989 CCTTCCCCGAACCCTAACCCTGG - Intergenic
1137775373 16:51049791-51049813 CATTCCCCCAACCCTCCCCCTGG + Intergenic
1139468748 16:67167323-67167345 CCTTCCCCCCAACCAGACCCAGG + Intronic
1142988929 17:3716080-3716102 CCTTCCCCCCACCCTGACCCCGG - Intronic
1142994676 17:3753668-3753690 GTTTCACCCAGCCCGGGCCCTGG + Intronic
1143597547 17:7924265-7924287 CTTTTCCCCAACCCCAACCCAGG - Exonic
1147135073 17:38429454-38429476 CTTGACCTCAACCTGGACCCCGG - Intronic
1147368903 17:39978045-39978067 CTTTCCCTCAACCCAGAGCTAGG - Intergenic
1148233451 17:45951681-45951703 CCTTCCCCCACCCCGCCCCCCGG + Intronic
1149603331 17:57907447-57907469 CTTTCCCACTACCCTGAACCTGG - Intronic
1151457580 17:74235500-74235522 CTTTCCCACAGCCCAGACCCAGG - Intronic
1151460264 17:74250079-74250101 CTTTCCCCTGCCCCGGCCCCAGG + Intronic
1151994731 17:77601401-77601423 CCTTCCCTCAACCCCGTCCCAGG + Intergenic
1152121842 17:78423634-78423656 CTTTCCCCAAAGCCTGAACCAGG + Intronic
1152129902 17:78469905-78469927 CATTCCCCCAGCCCCGCCCCTGG - Intronic
1152834576 17:82520534-82520556 CTTTCCCCCTTCCTGGAGCCGGG + Intronic
1155395813 18:25385780-25385802 CTTTCCCCCAACCCCGCAACAGG - Intergenic
1156202455 18:34849831-34849853 CTTTGCCACAACCCCTACCCTGG + Intronic
1156349942 18:36295485-36295507 CTCTGCCCCCACCTGGACCCTGG - Intergenic
1156458127 18:37306128-37306150 CTGGCCCCCCACCAGGACCCAGG - Intronic
1156687421 18:39666692-39666714 CTCTCCCCCAAGCCAGGCCCAGG - Intergenic
1157544634 18:48539261-48539283 CCTTCCCCCACCCCCGACTCGGG + Exonic
1157724343 18:49952336-49952358 ATTTCCCCCACCCCCGGCCCTGG + Intronic
1157858347 18:51121046-51121068 CCTTCCCCCACCCCGCACCTTGG - Intergenic
1162753508 19:12843420-12843442 TATTCCCCCAACCCCCACCCTGG + Intronic
1162829531 19:13275795-13275817 TTTTCCCCCAACCCCCAGCCTGG - Intronic
1162954594 19:14091020-14091042 CTTTCCCCCGCCCCCGCCCCGGG - Intronic
1163233970 19:16020475-16020497 CTGTCCCCCACCCCCGCCCCAGG - Intergenic
1165092237 19:33393299-33393321 CTCTCCCCCACGCCAGACCCCGG - Intronic
1165138942 19:33687823-33687845 CTCCTCCCCAACACGGACCCAGG - Intronic
1166054903 19:40282632-40282654 CTTTCACCCAGCCTGGAACCTGG + Intronic
1166214203 19:41325155-41325177 CTTTCCACCTACCCCGACCCCGG - Intronic
1166297810 19:41897334-41897356 CCTTCCCCCACCCAGGGCCCAGG - Intronic
1166871508 19:45873660-45873682 CTTTCCCCCAACTCTGGTCCAGG + Exonic
926400902 2:12495464-12495486 CTTTCTCACAACCTGGATCCTGG + Intergenic
927920826 2:26970853-26970875 CCCTCCCCCAGCCCGGGCCCTGG - Intronic
932418566 2:71588155-71588177 CTTCCCCCAAACCCGGCCCTTGG - Intronic
932887114 2:75558551-75558573 CTTTCCCCCAACCTGGGGCAGGG + Intronic
935341448 2:102063308-102063330 CTTCACCCCAACCTGGTCCCAGG + Intergenic
938216866 2:129525641-129525663 GTTTCCCCCAAACCCCACCCTGG + Intergenic
939552554 2:143633911-143633933 CTTACCCCCAACTCTGACTCAGG + Intronic
940699853 2:157027466-157027488 CTTTGCCCCAACCCAGATGCAGG + Intergenic
946301784 2:218828381-218828403 CTTTCCTCCACCCTGGCCCCTGG + Intronic
948283902 2:236769439-236769461 CTGTGCCCCAACCTGGGCCCAGG - Intergenic
1168922879 20:1555321-1555343 CTCTCCACCACCCCAGACCCTGG - Intronic
1172126728 20:32628903-32628925 CTGTCCCCCAAGCAGGGCCCTGG - Intergenic
1176056365 20:63151210-63151232 CTGTGCCCAAACCCGCACCCTGG + Intergenic
1176262595 20:64190275-64190297 CCTTCACCTAACCCGGACTCTGG - Intronic
1176377542 21:6093958-6093980 CTTCCCCACATCCGGGACCCTGG - Intergenic
1178594456 21:33940392-33940414 CTTTTCCCTTCCCCGGACCCTGG - Intergenic
1179745933 21:43444286-43444308 CTTCCCCACATCCGGGACCCTGG + Intergenic
1180301570 22:11040610-11040632 CTTTCCCCCAACCCCCAGACAGG - Intergenic
1182049985 22:27305280-27305302 CTTCCCCCCAGCCCTGACTCCGG + Intergenic
1183951335 22:41354732-41354754 CTGGCCCCCAACCCTGTCCCGGG + Intronic
1184175121 22:42784666-42784688 CCTTCCACCAGCCCGGTCCCAGG - Intergenic
1184242355 22:43217852-43217874 CTGTCCCCCGACCCTGACTCAGG + Intronic
1184978734 22:48081305-48081327 CTTTCCCCGGACCCTGACCTCGG - Intergenic
1185268897 22:49919167-49919189 CTCGCCCCCACCCTGGACCCGGG + Intronic
950469896 3:13177953-13177975 CTTTCTCCCCACCCAGCCCCAGG - Intergenic
951235128 3:20226201-20226223 CCTTCCCCCCACCCTGCCCCAGG + Intergenic
953406958 3:42664451-42664473 CCTGCCCCCAACCCAGCCCCAGG + Exonic
954453296 3:50583320-50583342 CTTTACCCCCACCTGGACCCTGG + Exonic
958791598 3:98657472-98657494 CTCTCCCCCGACCCCCACCCCGG - Intergenic
961486008 3:127217007-127217029 CTCTCCACCATCCCGGGCCCTGG + Intergenic
961653577 3:128429419-128429441 CCTGCCCCCATCCCGGGCCCTGG + Intergenic
967405064 3:189106280-189106302 CTTTCCCCCTTCCCCCACCCTGG + Intronic
968048260 3:195635720-195635742 CTTTCCCCAAACAAGCACCCTGG - Intergenic
968099144 3:195953900-195953922 CTTTCCCCAAACAAGCACCCTGG + Intergenic
968135381 3:196216601-196216623 CTTGCCCCCCACCCCGGCCCAGG + Exonic
968306350 3:197654201-197654223 CTTTCCCCAAACAAGCACCCTGG + Intergenic
968622683 4:1610848-1610870 CCTGCCCCCAACCCGGGCCCCGG + Intergenic
968654034 4:1771033-1771055 CCTAACCCCAACCCTGACCCTGG + Intergenic
969116691 4:4874630-4874652 CTTTCACCCAGCCCTGATCCAGG + Intergenic
969365803 4:6693704-6693726 CTTTCCCCCAGCCAAGGCCCAGG - Exonic
970038184 4:11763957-11763979 CCTTCCCCTAACCCAGACCCTGG + Intergenic
972702625 4:41508637-41508659 CTTTCTCCCACCCATGACCCAGG - Intronic
973330457 4:48906523-48906545 CTCTCCCCTAACTCGGACCCCGG - Intronic
978382170 4:108140639-108140661 CTTTCCCCTCACCCGGAGTCAGG + Intronic
979161300 4:117464650-117464672 CACTCCCCCCACCCGGTCCCTGG + Intergenic
983393533 4:167164589-167164611 CTTTCCCCCAACCCCCACACAGG + Intronic
985504748 5:272216-272238 CTTTCCCCAAACAAGCACCCTGG - Intronic
985743366 5:1633380-1633402 CTTTCCCCAAACAAGCACCCTGG + Intergenic
989103428 5:37840068-37840090 CCCTCCCCCACCCCGGACCCCGG - Intergenic
989385091 5:40846934-40846956 TTTTCCCCCAACCCTAAACCTGG - Intronic
990557587 5:56951715-56951737 GTTTCCACCCACCCGGGCCCGGG + Intronic
990667651 5:58091877-58091899 CTTTTCCCCACCCTTGACCCAGG - Intergenic
992042409 5:72848626-72848648 CTTCCCCCGCGCCCGGACCCAGG - Intronic
992056718 5:72997663-72997685 CTTTCCCCCAACCCCAACTCAGG - Intronic
992409739 5:76493468-76493490 CTGTCCCCCAGCCCTAACCCTGG + Intronic
994670371 5:102755494-102755516 CATCCCCCCACCCCCGACCCGGG - Intronic
996201454 5:120679830-120679852 CTGTCCCCCAACTCAGACCATGG - Intronic
996590866 5:125146512-125146534 CTTTCCCCCAAGCCAGACACTGG - Intergenic
999260997 5:150238936-150238958 CCTTTCCCCCACCCGGCCCCTGG - Intronic
999671445 5:153962123-153962145 CTTTCCCCCAACCCGCTAACAGG + Intergenic
999748453 5:154609341-154609363 CTATCCCCCAACCCCAACCCTGG - Intergenic
1000097727 5:157986261-157986283 CTCTGCCCCTCCCCGGACCCTGG + Intergenic
1001540575 5:172534844-172534866 CTTTCGCCCACCCCTGATCCAGG + Intergenic
1001831699 5:174794481-174794503 CTTTTACCTAACCCAGACCCAGG + Intergenic
1002555651 5:180037438-180037460 CTATCCTCCAACCCGCACTCAGG + Intronic
1004015527 6:11728576-11728598 CTCTCCCCCAACCCTGATTCGGG + Intronic
1006835662 6:36997480-36997502 CTGTTCCCCAACCCCAACCCAGG - Intergenic
1007363152 6:41372939-41372961 CCTTCCCCCATCCCGGCCGCTGG + Intergenic
1007503372 6:42315677-42315699 CCTCTCCCCAACCCTGACCCAGG - Intronic
1008524820 6:52397400-52397422 CTTCCCCCCAACGCTGCCCCAGG + Intronic
1008774681 6:55023407-55023429 CTTCCCCCACACCCAGACCCTGG - Intergenic
1010268688 6:73896278-73896300 CTTTCCTCCAACCCATTCCCTGG + Intergenic
1012426026 6:99115311-99115333 CTTTCTCCCTACCCTCACCCAGG - Intergenic
1017224779 6:152008235-152008257 CTCTCTCCCAACCCTGACCCAGG + Intronic
1019437783 7:1030842-1030864 CTTTCCCACAGCCCACACCCCGG + Intronic
1022644477 7:32217636-32217658 TTTTCCCCCAACCCCAACCATGG - Intronic
1025723504 7:64037314-64037336 CTGTGCCCCAACCCCGAGCCCGG + Intronic
1029214225 7:98934035-98934057 CTTGACCCAAACACGGACCCTGG + Intronic
1032441599 7:131946417-131946439 CTTTCCCACAACCTGGCCCCCGG - Intergenic
1032811120 7:135418973-135418995 CTTCCCCCCTACCCGCCCCCTGG + Intronic
1035325129 7:158061065-158061087 GTTTTCCCCAACCCTGAGCCAGG + Intronic
1035397876 7:158546906-158546928 CTGTCCCCCAGCCCTGCCCCAGG - Intronic
1039158715 8:34592938-34592960 CACTCCCCCACCCCGGCCCCTGG - Intergenic
1040010650 8:42658484-42658506 CATCCCCCCAACCCAGTCCCTGG - Intergenic
1041707619 8:60863245-60863267 CTTTCCCCGACCCCAGCCCCTGG + Intronic
1042426632 8:68656726-68656748 CTTTACTCCAACCCAGTCCCTGG + Intronic
1043443376 8:80296720-80296742 CTTTCCCCCAACCCTGTGACAGG - Intergenic
1048447796 8:134504947-134504969 CCTGCCCCCACCCCAGACCCAGG + Intronic
1048571900 8:135663514-135663536 CTCTCCCCCAACCCAGCGCCTGG + Intergenic
1049966324 9:783558-783580 GTTACCCCCATCCCAGACCCAGG + Intergenic
1053142726 9:35691111-35691133 CTTTCCCCCCACCCCACCCCAGG - Intergenic
1053157529 9:35791490-35791512 CCTTCCCCCACCCCCCACCCGGG - Intergenic
1053422884 9:37991528-37991550 CATTCCCCCAAACATGACCCTGG + Intronic
1056699464 9:88890216-88890238 ATTTCCCCCACCCCAGCCCCGGG - Intergenic
1056898707 9:90578160-90578182 CTTTCCCCAAATCCAGCCCCTGG + Intergenic
1057026348 9:91736682-91736704 CTTTCCCCTAAGAAGGACCCCGG + Intronic
1058237137 9:102504016-102504038 CTTTACCCTCACCTGGACCCTGG - Intergenic
1058663027 9:107283449-107283471 CTCTCCCCCAGCCCGTGCCCCGG - Exonic
1060597213 9:124855824-124855846 CTTTCCACCTTCCCCGACCCCGG + Intronic
1061220110 9:129245562-129245584 ATCTCCCCCGACCCGCACCCCGG + Intergenic
1061961521 9:133991506-133991528 CTCTTCCCGGACCCGGACCCGGG - Intronic
1062198982 9:135290779-135290801 CTGTCACCCCACCCGGTCCCCGG - Intergenic
1062665430 9:137668622-137668644 CACTCCCCCAACCCAGTCCCTGG + Intronic
1185540535 X:899769-899791 CTTTCCCCCAACCCCCAGACAGG + Intergenic
1187399385 X:18946364-18946386 CTTTCCTCCAACCCCGGCACTGG + Intronic
1188028391 X:25235333-25235355 ATTTCCCCCACCCCAGACCCTGG - Intergenic
1189633862 X:42983998-42984020 CTTTCCCCCAACTCTGAAGCAGG - Intergenic
1190107122 X:47568908-47568930 CTTTCCCCCCACCCCTCCCCAGG - Intronic
1190863346 X:54363858-54363880 CTCTTCCCCCACCCCGACCCAGG - Intergenic
1192149782 X:68705125-68705147 CCTGCCCCCAACCCAGTCCCAGG - Intronic
1198280173 X:135133748-135133770 CTTACCCCCACCCCCCACCCCGG - Intergenic
1198290785 X:135238766-135238788 CTTACCCCCACCCCCCACCCCGG + Intergenic
1198709030 X:139481369-139481391 CTTTCCCCCAACCCCGTGACAGG + Intergenic
1199566588 X:149222127-149222149 ATTTGCCCCAACCCAGACTCTGG + Intergenic
1200211514 X:154348763-154348785 CTTCCCCTCAACCCCGGCCCAGG - Exonic
1200829836 Y:7679294-7679316 GTTTCCCCCAACCCTGCTCCCGG - Intergenic
1202109581 Y:21406107-21406129 GTTTCCCCCAACCCCGCTCCTGG - Intergenic
1202197092 Y:22307483-22307505 GTTTCCCCCAACCCCGCTCCCGG + Intergenic