ID: 1117980286

View in Genome Browser
Species Human (GRCh38)
Location 14:61336170-61336192
Sequence AGTTAACTTCAGAAAAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 412}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117980286_1117980289 21 Left 1117980286 14:61336170-61336192 CCAGCCCTTTTCTGAAGTTAACT 0: 1
1: 0
2: 2
3: 30
4: 412
Right 1117980289 14:61336214-61336236 TTTACATAGAATTCAAGAGAAGG 0: 1
1: 0
2: 3
3: 39
4: 408
1117980286_1117980290 22 Left 1117980286 14:61336170-61336192 CCAGCCCTTTTCTGAAGTTAACT 0: 1
1: 0
2: 2
3: 30
4: 412
Right 1117980290 14:61336215-61336237 TTACATAGAATTCAAGAGAAGGG 0: 1
1: 0
2: 3
3: 46
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117980286 Original CRISPR AGTTAACTTCAGAAAAGGGC TGG (reversed) Intronic
900359004 1:2278998-2279020 AGTAAGCTCCAGACAAGGGCAGG + Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902137633 1:14323993-14324015 AGATAAATTCAGAAAAGAGTTGG - Intergenic
902822772 1:18953654-18953676 AGTTAACTTCAGAAAATAAATGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905250833 1:36647251-36647273 AGCTAGCTTCAGAAAGGGGCTGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
908877801 1:68697737-68697759 GGTGGACTTCAGAAAAGAGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910467178 1:87512729-87512751 AGTTAAGTTCATGAAATGGCAGG - Intergenic
910847728 1:91619437-91619459 ATTTAAAATCAGAAATGGGCTGG - Intergenic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912515834 1:110216152-110216174 AGGGAACTTCAGAAGCGGGCAGG - Intronic
912731178 1:112106928-112106950 AGCTAACTTCAGGATAGGGCTGG - Intergenic
912775228 1:112502533-112502555 AGGAAACCTCAGAGAAGGGCTGG + Intronic
915253057 1:154604245-154604267 AGTCACCATCAGAAAAGAGCAGG - Intronic
917156901 1:172012263-172012285 AGTTAGATTCAGCAAAGGGAAGG + Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
922139525 1:222869416-222869438 ACCTAAATTGAGAAAAGGGCTGG - Intergenic
922207239 1:223459021-223459043 ACTTAACTTCATAAAAGGGTAGG - Intergenic
922759973 1:228122422-228122444 AGGTAGCTTCAGAATGGGGCTGG - Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063182531 10:3617665-3617687 ACTTAACTTCATAAAGAGGCGGG + Intergenic
1063513289 10:6668520-6668542 AGTAATCTTCAGAAAGGTGCTGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064517680 10:16168495-16168517 AGGTTACTTCATAAATGGGCTGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066020123 10:31290226-31290248 AGTTAAATTCAGGAAAGTGTGGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067821491 10:49534937-49534959 AGTTAACAACAGAGCAGGGCAGG + Intronic
1067844457 10:49708884-49708906 AGTTCACTTCAGAAGATGGTGGG - Exonic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069851869 10:71410650-71410672 AGTTAACTTCAGAGGATGACGGG - Intronic
1071239767 10:83692646-83692668 AGTTAACAGCAGACAGGGGCAGG - Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071575222 10:86720499-86720521 AGTTAACTTCAGAGCTGGGAAGG - Intronic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072076193 10:91976486-91976508 AGATAGCTTCAGAAGGGGGCTGG - Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074745036 10:116524029-116524051 ATTTCACTTCAGAAAATGGCAGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078332124 11:10431608-10431630 AGAAAACTTCAGAATAGGACTGG + Intronic
1078529642 11:12127107-12127129 GTTTAACTTCAGAACAGGGATGG + Intronic
1078724098 11:13913139-13913161 AGTTCACATCAGAAAAGGACTGG + Intergenic
1080604417 11:33852955-33852977 GATTAACTTCAGAGAAGAGCCGG - Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088238400 11:107749524-107749546 ACATAACCTCAGTAAAGGGCAGG + Intergenic
1088788001 11:113200201-113200223 AGTGAACTCCAGAAAAGATCAGG + Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091098430 11:132846055-132846077 AGTTAATTAAAGAAAAGGGCAGG + Intronic
1091980613 12:4861133-4861155 ACTGCCCTTCAGAAAAGGGCAGG + Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094348819 12:29500094-29500116 AAATAACTTCAGAAAAGGAAAGG + Intergenic
1094715090 12:33005834-33005856 AGTAAAATTCATAATAGGGCAGG - Intergenic
1095109095 12:38271654-38271676 AGAAGACTTCAGAAAAGGGATGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104256517 12:127143764-127143786 AATTAACACCAGAAAAGGGGAGG - Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106890363 13:34238962-34238984 ATTTAACCCCAGAAAAGAGCAGG + Intergenic
1108021054 13:46127982-46128004 ACTTAACTTAAAAAAAAGGCAGG - Intronic
1110688352 13:78401965-78401987 AGTGGACTGCAGAAAAGGACTGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111720986 13:91944885-91944907 AGTTAACACCAGAAAATGGGGGG - Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112625065 13:101094302-101094324 ACTTAACGTCAGAGATGGGCAGG - Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114383044 14:22228943-22228965 AGATAGCCTGAGAAAAGGGCAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116546403 14:46170747-46170769 AGTTAAAAAAAGAAAAGGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117980286 14:61336170-61336192 AGTTAACTTCAGAAAAGGGCTGG - Intronic
1118079259 14:62339425-62339447 ACTTAACTACACAAAAAGGCAGG - Intergenic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1123035939 14:105471991-105472013 TGTTGACTCCAGAAAAGGACAGG - Intergenic
1123679717 15:22752937-22752959 AGTTAACACCAGAAAATGGGGGG - Intergenic
1123713209 15:23006634-23006656 AGTAAACTTCAGGCAATGGCTGG + Intronic
1124331936 15:28827415-28827437 AGTTAACACCAGAAAATGGGGGG - Intergenic
1125335783 15:38624967-38624989 AGTTAATTTTAAAAAAGGGGTGG - Intergenic
1125705929 15:41736169-41736191 ATTTTACATCAGAAAAGAGCTGG + Exonic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1135940400 16:26817180-26817202 GGTTAATTTCAGAGAAGGTCAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138364978 16:56467725-56467747 AGTTTACTTAAGAAAAGTGTAGG - Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139125633 16:64072951-64072973 AGTGAACTTCAGAAATAGGGAGG + Intergenic
1139370711 16:66467756-66467778 AGTGAACTTCAGCAAAGGCTTGG + Intronic
1139385715 16:66567983-66568005 AGTTAACTTGTAAAAAGGTCTGG - Intronic
1140090002 16:71830197-71830219 AGTGAACATAAGAAAAGGCCGGG + Intergenic
1141012750 16:80418122-80418144 TGTCAACTTCAGAGAAGGCCAGG + Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143761202 17:9105343-9105365 AGATACCTTCAGAAAAGGCCCGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1147020570 17:37529164-37529186 AGGTAAATGGAGAAAAGGGCTGG - Intronic
1149142263 17:53446004-53446026 ATTTAACTTCATAAAAAGGAAGG - Intergenic
1149506009 17:57194594-57194616 AGTGAACTTCTGAGAGGGGCAGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152460545 17:80439883-80439905 AGTAAAGTGCAGAAAGGGGCAGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156602613 18:38627308-38627330 AGATATCTGCAGAAAAGGTCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156911652 18:42417615-42417637 ACTGGACTTCAGAGAAGGGCTGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157349432 18:46871426-46871448 AGGTAACCTCAGAACAGGGAGGG + Intronic
1158127507 18:54118139-54118161 AGTTAAATTTTGAAAAGTGCTGG - Intergenic
1158705906 18:59791718-59791740 AATTAAATTCAGATAAGGCCAGG + Intergenic
1158856763 18:61550518-61550540 AGTTTACTTCAGAACAAAGCAGG + Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160284468 18:77527978-77528000 AGTTTACTTCAGAAAAATGTGGG - Intergenic
1160496361 18:79378198-79378220 GGGTATCTTCAGCAAAGGGCAGG - Exonic
1161238919 19:3211141-3211163 AGGGAACTTCAGAAACAGGCAGG + Intergenic
1161509222 19:4661476-4661498 AGTTAACTTAAGAAGTGGGGAGG + Intronic
1162232545 19:9279692-9279714 AGTGAACTTAAGAAAAGGTCAGG + Intergenic
1162938754 19:13995542-13995564 GGCTGACTTCAGAACAGGGCCGG + Intronic
1163966760 19:20753347-20753369 AGAAAACTGCAGAAAAAGGCTGG - Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165383072 19:35494717-35494739 AGATGACTTCAGAGAAGGACAGG + Intronic
1167114205 19:47479665-47479687 AGTTAAATTCACAAGAGGGGAGG + Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925320363 2:2961652-2961674 AGTTCTCCCCAGAAAAGGGCAGG - Intergenic
926108580 2:10167766-10167788 AGTTATCTTCAGATGAGGACAGG - Intronic
926692940 2:15749738-15749760 ATTTCACTTCTGAAAATGGCTGG + Intergenic
927730456 2:25466489-25466511 AGTTGACAGCAGCAAAGGGCAGG + Intronic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
931588569 2:63855836-63855858 AGAAAACTACAGAAAAAGGCTGG - Intronic
932647575 2:73520051-73520073 AGATAACTACACAAAAGAGCTGG - Intronic
933158437 2:78999058-78999080 CATTAAAATCAGAAAAGGGCTGG + Intergenic
934722301 2:96588888-96588910 AGAAAACTTAAGAAAAGGGCTGG - Intergenic
934891067 2:98069636-98069658 AATTAACTTCATAAAAGGTTGGG + Intergenic
935148528 2:100413188-100413210 AGTTAATTACAGAAAATGCCAGG - Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936045685 2:109186092-109186114 TTTTAACTTCAGGAGAGGGCAGG + Intronic
936802527 2:116285563-116285585 AGTTAACAACAGAAGAGGGAAGG + Intergenic
937371458 2:121300496-121300518 AATTTACTTCAGAAAAGGCAAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939456693 2:142446287-142446309 AGTTCCCTTGATAAAAGGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940070448 2:149681120-149681142 AGTTAATTCCAGAAAAAGGAGGG - Intergenic
940543221 2:155048517-155048539 TCTTAATTTCAGAAAAGGGGAGG + Intergenic
940962581 2:159801528-159801550 AGTTAACTTCAGTAAAGTTGAGG - Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942373352 2:175310106-175310128 AGTGTACCTCAGAAAAGGGAAGG - Intergenic
942561144 2:177220297-177220319 ATTTAAATTCTGAAAAGGGATGG + Intronic
943002186 2:182342064-182342086 AGATAACTATAGAAAAGGGCCGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943592464 2:189815294-189815316 GGTTAACTGGAGAAAAGGGGTGG - Intronic
943807530 2:192140867-192140889 AGTTGATTTCTGAATAGGGCAGG + Intronic
944066532 2:195624914-195624936 AGTAAACTTCTAAAAGGGGCCGG + Intronic
944306231 2:198183248-198183270 AGTCATCTTCAGAAAAAGGGAGG + Intronic
945515341 2:210757193-210757215 AGTTAACTTGAGACATTGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
947051519 2:226049092-226049114 AGTTTACTTCATAAAAGAGTTGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1169906281 20:10607968-10607990 ATTCTACTTCAGCAAAGGGCAGG - Intronic
1170146406 20:13180003-13180025 TGATGACTTCAGAGAAGGGCAGG - Intergenic
1174251747 20:49225183-49225205 TGCTACCTTCAGAAGAGGGCGGG - Exonic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177058706 21:16342949-16342971 AGTTAGCTTTATAAAAGGACAGG - Intergenic
1177750922 21:25283089-25283111 AGTTAAATTTAAAAAAGAGCTGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178634463 21:34290168-34290190 AATTACCTTCAGATAATGGCAGG - Intergenic
1179960050 21:44763032-44763054 AGAGAACTTCACAAAAGAGCAGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180701186 22:17782192-17782214 AGTTCACTTCAGAAAGGGCAGGG - Intergenic
1182856787 22:33524566-33524588 ATGTAATTTCAGAAAAGGGTGGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949417637 3:3831149-3831171 AGTTCACTTGATAAATGGGCCGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952814420 3:37434852-37434874 ACTGAAGTTCAGAAAAGGGAGGG + Exonic
953400330 3:42608731-42608753 AGATAGCTTCAGGATAGGGCTGG - Intronic
954005683 3:47588586-47588608 AATTAACTTCTGAAAGGGCCTGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956490671 3:69768189-69768211 AATTAACTTCAGGAAAGGAGGGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957958974 3:87225894-87225916 AGCTCACTCCAGAAAAGGCCCGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958772270 3:98438981-98439003 AGTTAACCTGTGAAATGGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
961855724 3:129869091-129869113 AGATAGCTTCAGGATAGGGCTGG + Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968028011 3:195458766-195458788 ATTTATCCTCAGAAAAGGACAGG + Intergenic
968433608 4:574142-574164 AGTTAGCTTTAGAAAGAGGCTGG + Intergenic
968799817 4:2734625-2734647 AGGTAACTGAAGAAAAGAGCTGG + Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
971189075 4:24409883-24409905 AGTTGACCACAGCAAAGGGCAGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973130193 4:46639725-46639747 AGTTATATTCAGAACATGGCAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974362435 4:60899633-60899655 AGGTAAGCTCAGAGAAGGGCTGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
975986736 4:80207298-80207320 AGTCACACTCAGAAAAGGGCTGG + Intergenic
976348335 4:84030836-84030858 AGATAACTTGAGAAAATTGCTGG - Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978870141 4:113565836-113565858 TGTTGAGTTCAGAAAAGGCCAGG - Intronic
979581071 4:122361316-122361338 ACTTAACTTCGGGGAAGGGCGGG + Intronic
979896342 4:126162667-126162689 AGTTAAGGTCAGAAAAGAGAGGG + Intergenic
980263169 4:130480842-130480864 AAATAACTTCAGAAGAGGACAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983784024 4:171709773-171709795 AGTTTAATTCTGAAAATGGCTGG + Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984297365 4:177869176-177869198 AGATAACTTCAAATAATGGCAGG - Intronic
984784976 4:183559209-183559231 AGTGAAGCGCAGAAAAGGGCAGG - Intergenic
984987568 4:185346153-185346175 AGTTAACAATAGAAAATGGCCGG - Intronic
985427179 4:189842462-189842484 AGATAGCTTCAGAATGGGGCTGG - Intergenic
985945935 5:3183582-3183604 TGTTAATTTCAGCAATGGGCTGG + Intergenic
986390684 5:7284741-7284763 AGTTAACACCAGAAAATGGGGGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987504385 5:18749824-18749846 AGTTAACTACAGAAGATGACAGG - Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989856684 5:46304077-46304099 AATTAACTTCAGAAAAAAACTGG - Intergenic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991272893 5:64806889-64806911 AGTTAACTTCAGAGACTCGCTGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
999145405 5:149389990-149390012 AGTCAACTTCAGCCAAGGCCTGG + Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000580592 5:163031275-163031297 AGATAACTTCAGAATGGAGCTGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1004074876 6:12335980-12336002 AGTTAATTGCAGAATAGGACAGG - Intergenic
1004108576 6:12690614-12690636 AGTGAGCCTCAGAAAGGGGCAGG + Intergenic
1004612088 6:17251861-17251883 AGTTGACTTGAGAAAAGTGAGGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG + Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010706824 6:79124490-79124512 AATTAACTACAGACAAGAGCAGG + Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014353452 6:120373515-120373537 AGTAAACTTCAGGAAAGAGATGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017174098 6:151485660-151485682 AGTTACCTTCAGCCAAGGTCAGG - Intergenic
1017838110 6:158198822-158198844 AATTAACTGCAGGAAAGGGAGGG - Exonic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018017327 6:159724281-159724303 AAAGAAGTTCAGAAAAGGGCCGG - Intronic
1018340904 6:162850416-162850438 AGGTAGCTTCAGAAAGGAGCTGG + Intronic
1018444211 6:163840543-163840565 AGTTCACTTCAGAAATTTGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020228318 7:6297673-6297695 GGTTAACATCAGAAGAGGGTAGG - Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021842168 7:24729640-24729662 AGTGAACATCAGACAAGGACTGG + Intronic
1022683043 7:32568014-32568036 AATTAAATTAAAAAAAGGGCTGG - Intronic
1023314454 7:38921024-38921046 ACTTAACTAAAGCAAAGGGCAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024186782 7:46957403-46957425 TGTTTTCATCAGAAAAGGGCAGG + Intergenic
1024281920 7:47725385-47725407 AGATAACCCCAGAAATGGGCAGG - Intronic
1027343459 7:77234095-77234117 GTTTACCTTCAGAAAATGGCTGG + Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027812879 7:82927901-82927923 TGTTAGCTTCAGAAAATGGGAGG + Intronic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028674411 7:93442455-93442477 TGTAAACTGCAGAAAGGGGCTGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1031548033 7:123074434-123074456 AGTTAGCATGAGATAAGGGCTGG + Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1036817014 8:11909838-11909860 AGAAAACTGCAGAAAAAGGCTGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037585968 8:20276271-20276293 TGGTAGCTTCAGAATAGGGCAGG + Intronic
1041668519 8:60469072-60469094 GCTTGACTTCTGAAAAGGGCTGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043829997 8:84976730-84976752 AGCTAACTTCAGAAAGATGCTGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044487195 8:92767390-92767412 AGTTCACTTGATAAATGGGCTGG + Intergenic
1045048303 8:98300311-98300333 AGTTAACTTCAGCACAAGGGTGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046232131 8:111372031-111372053 AGTTAACATCACCAAATGGCTGG - Intergenic
1046476133 8:114746207-114746229 ATTTAACATCAAAAAAGGGGAGG - Intergenic
1047343387 8:124004157-124004179 AGATAATTTCAGAAAACAGCTGG + Intronic
1048277304 8:133076793-133076815 AGTTAAGTACAGGGAAGGGCAGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052286242 9:26789065-26789087 AATAAACTTCAGAAAGGGGAGGG + Intergenic
1053103096 9:35388018-35388040 AATTAACTAAAGAAAGGGGCTGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057107427 9:92432915-92432937 AGTTAATTGGAGGAAAGGGCAGG + Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058726319 9:107808181-107808203 AGTTAAAGTCAGGAAATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059879025 9:118668909-118668931 AGTAAAATTTAGCAAAGGGCCGG - Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1185739926 X:2523553-2523575 AGAAAACATCAGAAAAGGCCAGG + Intergenic
1186255196 X:7710289-7710311 AATTAACTCCAGAAGAGTGCAGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187526050 X:20056270-20056292 AGTTATCCTCCAAAAAGGGCTGG - Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188882008 X:35500929-35500951 ATAAAACATCAGAAAAGGGCTGG + Intergenic
1190229876 X:48574083-48574105 GGTTAACATCAGAGAATGGCAGG + Intergenic
1190410380 X:50131281-50131303 AGGTATCTTCAGAAAAGAGTGGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193973601 X:88089269-88089291 AATTGAAATCAGAAAAGGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195976549 X:110533666-110533688 ATCTAACTTCAAAAAAAGGCTGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196867000 X:120078993-120079015 AGATATCTGTAGAAAAGGGCAGG - Intergenic
1196876099 X:120157289-120157311 AGATATCTGTAGAAAAGGGCAGG + Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200911800 Y:8537778-8537800 AGAAAACTTCAGAAACAGGCTGG + Intergenic
1200947957 Y:8864998-8865020 AGAAAACTGCAGAAAAAGGCTGG + Intergenic
1201694409 Y:16808889-16808911 AGTTGTCTTCAGAAGTGGGCTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic