ID: 1117980618

View in Genome Browser
Species Human (GRCh38)
Location 14:61339238-61339260
Sequence GTCCCCTCTGTGTTCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 273}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117980609_1117980618 13 Left 1117980609 14:61339202-61339224 CCTGTTCAGGCTTAGCCCTCCAC 0: 1
1: 0
2: 0
3: 3
4: 128
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980608_1117980618 16 Left 1117980608 14:61339199-61339221 CCTCCTGTTCAGGCTTAGCCCTC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980612_1117980618 -2 Left 1117980612 14:61339217-61339239 CCCTCCACCTGCTCTGCCTGGGT 0: 1
1: 0
2: 5
3: 54
4: 505
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980615_1117980618 -9 Left 1117980615 14:61339224-61339246 CCTGCTCTGCCTGGGTCCCCTCT 0: 1
1: 0
2: 4
3: 99
4: 1289
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980613_1117980618 -3 Left 1117980613 14:61339218-61339240 CCTCCACCTGCTCTGCCTGGGTC 0: 1
1: 0
2: 4
3: 74
4: 608
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980614_1117980618 -6 Left 1117980614 14:61339221-61339243 CCACCTGCTCTGCCTGGGTCCCC 0: 1
1: 0
2: 7
3: 91
4: 694
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117980618 Original CRISPR GTCCCCTCTGTGTTCTCCCT GGG Intronic