ID: 1117980618

View in Genome Browser
Species Human (GRCh38)
Location 14:61339238-61339260
Sequence GTCCCCTCTGTGTTCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 273}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117980614_1117980618 -6 Left 1117980614 14:61339221-61339243 CCACCTGCTCTGCCTGGGTCCCC 0: 1
1: 0
2: 7
3: 91
4: 694
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980612_1117980618 -2 Left 1117980612 14:61339217-61339239 CCCTCCACCTGCTCTGCCTGGGT 0: 1
1: 0
2: 5
3: 54
4: 505
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980609_1117980618 13 Left 1117980609 14:61339202-61339224 CCTGTTCAGGCTTAGCCCTCCAC 0: 1
1: 0
2: 0
3: 3
4: 128
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980615_1117980618 -9 Left 1117980615 14:61339224-61339246 CCTGCTCTGCCTGGGTCCCCTCT 0: 1
1: 0
2: 4
3: 99
4: 1289
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980608_1117980618 16 Left 1117980608 14:61339199-61339221 CCTCCTGTTCAGGCTTAGCCCTC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273
1117980613_1117980618 -3 Left 1117980613 14:61339218-61339240 CCTCCACCTGCTCTGCCTGGGTC 0: 1
1: 0
2: 4
3: 74
4: 608
Right 1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117980618 Original CRISPR GTCCCCTCTGTGTTCTCCCT GGG Intronic
900271372 1:1791002-1791024 GCTCCCTCTGTGCCCTCCCTTGG + Intronic
900666873 1:3821480-3821502 GTCCACTCTGTGGTGACCCTAGG - Intronic
901665864 1:10825844-10825866 GGCCTCTCTGAGTTCTCTCTGGG - Intergenic
901807773 1:11748959-11748981 GTCTCCTCTCTGTTCTCACCGGG + Intronic
902497424 1:16883330-16883352 GTCCCCACGGTTTTCTCCCTAGG - Intronic
903720028 1:25398273-25398295 GCCCCATCTCTGGTCTCCCTTGG + Intronic
904829296 1:33296401-33296423 TGTCCCTCTGTGTCCTCCCTGGG + Intronic
904885206 1:33732505-33732527 TTCCTCTCTGTGTTCTCACGTGG - Intronic
904970834 1:34418345-34418367 GTCCCCTCTGGGAACCCCCTGGG + Intergenic
905103489 1:35546157-35546179 GTCCCACTTGTGGTCTCCCTGGG - Intronic
907193154 1:52665439-52665461 GTCCCCGATGTCTTCTACCTGGG + Intronic
908107775 1:60862999-60863021 GTCTCCTCTGCTTTCTCCCAGGG - Intergenic
908620135 1:65969407-65969429 GTCCCAGCTGTCTTCTTCCTAGG - Intronic
911428739 1:97756123-97756145 TTCCCTTCTGTGTTCCCCCTTGG - Intronic
914522312 1:148428612-148428634 GTCCCCATGGTTTTCTCCCTAGG + Intergenic
916309033 1:163373631-163373653 CTCACGTCTGTGTTCTCCCATGG + Intergenic
916891012 1:169112480-169112502 GTCCCTTCTCTGCTTTCCCTTGG + Intronic
918366244 1:183810843-183810865 GTCCCTTCTGTGTGCTCCAGAGG + Intronic
919218798 1:194598281-194598303 GTCCCCTCTTTGTGCTAGCTGGG + Intergenic
919691315 1:200530883-200530905 GTCCTCTCTGAGATCTCCCCGGG - Intergenic
920118133 1:203635861-203635883 GATCCCTCTGTGTGCTCCATGGG - Intronic
920299324 1:204978778-204978800 GTCTCCTCTTTGTTTTCCCTTGG + Intronic
920512264 1:206559973-206559995 TTCCACTCTCTTTTCTCCCTTGG + Intronic
920564225 1:206960791-206960813 ACCCCCTCTATGTCCTCCCTTGG + Exonic
923149170 1:231218588-231218610 TTCCTCTCTCTGTTCTCCTTGGG + Intronic
923787687 1:237084013-237084035 GACCCACCTCTGTTCTCCCTGGG + Intronic
923993893 1:239470171-239470193 TTCTCCTCTGTGTTCTCCTCTGG - Intronic
924654494 1:245961142-245961164 GTCTACTCTGCATTCTCCCTTGG + Intronic
924740153 1:246790165-246790187 GCCCCCTCAGTGACCTCCCTCGG - Intergenic
1063010960 10:2020991-2021013 TTCCCCTCTGTGTCCTCACAGGG - Intergenic
1063248845 10:4252222-4252244 CTCCCTTCTGTGTTTCCCCTAGG + Intergenic
1063796313 10:9517337-9517359 CTTCTCTCTGTGTTCTCCCAGGG - Intergenic
1064857682 10:19789189-19789211 TTCCCCTGTGTTTTCTCCCGAGG - Intronic
1065065219 10:21956151-21956173 TTGCCCTCTGTGTTCTGCCATGG - Intronic
1065124084 10:22556193-22556215 GTGCCCTCTGTGTTCCCCGTGGG - Intronic
1065859307 10:29858139-29858161 CTACCCTCTGAGCTCTCCCTGGG - Intergenic
1066521457 10:36224533-36224555 TTTCCCTCCCTGTTCTCCCTTGG - Intergenic
1066998184 10:42582607-42582629 GTCCCATCTGTGGTCTCCAAAGG - Intronic
1067488348 10:46673913-46673935 TTCCTCTCTGTTTTCTCCCGTGG - Intergenic
1069725520 10:70575422-70575444 GCTCCCTCTGTGTCCTCCATAGG + Intergenic
1069811304 10:71161927-71161949 GTCCCCTCTCTCTCCTTCCTGGG - Intergenic
1069964822 10:72105697-72105719 ATTCCCTTTGTGTTCTCCCTAGG - Intronic
1070662425 10:78316825-78316847 GTCCCCTGTGTTTTCTCCAGGGG + Intergenic
1071112927 10:82183236-82183258 TTCCTCTCTCTGTTCTCCCCTGG + Intronic
1071592338 10:86886638-86886660 AGCCTCTCTGTGCTCTCCCTAGG - Intronic
1071601737 10:86961832-86961854 GTCACCTCTGTGTTGCCCCAGGG - Intronic
1071622021 10:87129468-87129490 TTCCTCTCTGTTTTCTCCCGTGG + Intronic
1072543270 10:96414453-96414475 CTCCTCACTGTCTTCTCCCTGGG + Intronic
1073471814 10:103727303-103727325 GTCCATGCTGTGTTCTCCTTGGG + Intronic
1075439424 10:122467614-122467636 GTCACCCCTGTGGTCTCCCGGGG - Intronic
1075922929 10:126227958-126227980 GTCCCCACTGTCTCCTCCCTAGG - Intronic
1076668807 10:132107936-132107958 GGGCCCTCTCTGTTCTCCATGGG - Intronic
1076726913 10:132418269-132418291 GTCATCTCTGAGATCTCCCTTGG - Intergenic
1076858411 10:133128393-133128415 GTCACCTGTGTGTACTTCCTGGG + Exonic
1077036790 11:499275-499297 CTCCCCTCAGTCTTCTGCCTGGG + Intronic
1078441389 11:11371612-11371634 GCCCCCACTGTCTTCTCCGTGGG - Intronic
1078628138 11:12977164-12977186 GTCAGCTATGTCTTCTCCCTTGG + Intergenic
1079244190 11:18741133-18741155 GTCCCCTCTCTGAGCTTCCTGGG - Intronic
1079716704 11:23756723-23756745 CTCCCCGCTGTGTGCTGCCTTGG + Intergenic
1080416481 11:32074076-32074098 ACCCCATCTGTGTTCTTCCTAGG - Intronic
1080826622 11:35853995-35854017 GTCCCCTCTGTCTCCTGCCTTGG + Intergenic
1081622160 11:44624986-44625008 CTCCCCTCTGTGGGCTCCCTTGG - Intergenic
1083763605 11:64831908-64831930 GGTCCCTCTGTGTTCCCACTAGG - Intronic
1083987679 11:66227140-66227162 CTCCCCTCTATGTCCTTCCTGGG + Intronic
1084020027 11:66411781-66411803 GTCTCCTCTTTGTTGCCCCTCGG + Intergenic
1084403292 11:68956953-68956975 TCCCCCTCTGTCTTGTCCCTGGG - Intergenic
1084633669 11:70375076-70375098 GTCACCTGTGTGTTCTGCGTCGG - Exonic
1084653935 11:70504445-70504467 GGCCCCACTGAGTCCTCCCTGGG - Intronic
1084693712 11:70741597-70741619 GTACCCTGTGTGTCCTCCCCAGG + Intronic
1084906143 11:72349425-72349447 ATCCCTGCTGTGTTCTTCCTTGG + Intronic
1085027106 11:73242720-73242742 GTCCACTCTGTGCTCTGCCCTGG + Intergenic
1088083079 11:105943987-105944009 GTTTCCTTTGTGTTCTTCCTTGG - Intronic
1089338954 11:117744783-117744805 GTGCCCCCTGTGGTCTCCCGTGG - Intronic
1090345422 11:126065363-126065385 GACCTCTCTGTGTCCTCCCACGG - Intergenic
1093738906 12:22658216-22658238 GGCCCCTCTGTTCTCTCCATTGG - Intronic
1093757106 12:22864898-22864920 TCCCTCTCTGTGTTCTCACTGGG - Intergenic
1094066400 12:26365094-26365116 CTCCCTTCTGTGTTCTACCTGGG - Intronic
1095232315 12:39754105-39754127 TTCCCCTCTATGTCCTCCTTTGG - Intronic
1096550755 12:52370163-52370185 GTGTTCTCTGTGTCCTCCCTGGG - Intergenic
1096673285 12:53213045-53213067 GTCCCCTCTCTGTCTTCCCAGGG - Intronic
1097014812 12:55978149-55978171 GGCTCCTCTGTGATCTCCCTTGG - Intronic
1098343408 12:69474402-69474424 TTCCCCTCTACATTCTCCCTTGG - Intronic
1101527589 12:105545806-105545828 GCCCCTTCTATGTTCTCCCATGG - Intergenic
1103622806 12:122199233-122199255 GTCCCCTCTGTGTTCTAGCCTGG + Intronic
1103926604 12:124426865-124426887 GTCCCCTCTGTGTCTTCCCTGGG - Intronic
1107833847 13:44398042-44398064 ATCTCCTCTGTGGTCTGCCTCGG + Intergenic
1109567006 13:64131140-64131162 GTCCCATCTGTTGTCTCCCTAGG - Intergenic
1112770388 13:102788832-102788854 GTGCCCGCTGTGTTCAGCCTAGG + Intronic
1113749697 13:112768748-112768770 GACCCCTCGGTGTTCCCGCTGGG + Intronic
1115293684 14:31801796-31801818 GTTCCCTCTGTGTTCTTCCAGGG + Intronic
1117073247 14:52075103-52075125 CTCCCCTCTGTGTTTTTGCTTGG - Intergenic
1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG + Intronic
1118372800 14:65152186-65152208 GTCCCCTCAGTATTCCTCCTGGG - Intergenic
1118600552 14:67468939-67468961 GCCCCCTCAGTCTTCTCGCTCGG + Intronic
1119160827 14:72451279-72451301 CTCCACTCTGTGGTCTCCATGGG + Intronic
1121276400 14:92671029-92671051 GTCCCATGTGTGTTCTTACTGGG - Intronic
1121313379 14:92946993-92947015 GCCTCCCCTGTGTCCTCCCTGGG - Intronic
1122092373 14:99348999-99349021 GTCCCCGGTGTGATCTGCCTTGG + Intergenic
1122323569 14:100869388-100869410 GTCCCCTCTCTATTCCCCATGGG + Intergenic
1122323756 14:100870430-100870452 GTCCCCTCTCTATTCCCCATGGG + Intergenic
1122892140 14:104737112-104737134 GTCACCTCTGGGTTCACACTTGG + Intronic
1123694016 15:22863788-22863810 CTCACCTCTGCCTTCTCCCTTGG - Intronic
1124254834 15:28131978-28132000 GTCCCCCGTGTGTGCTCCTTAGG - Intronic
1124394014 15:29284808-29284830 CTGCACTCTGTCTTCTCCCTTGG - Intronic
1125746793 15:42002563-42002585 GGGCCCACTGTTTTCTCCCTTGG + Intronic
1127780223 15:62306309-62306331 TTGCCCACTGTGTTCTTCCTGGG - Intergenic
1129387529 15:75203933-75203955 GGCCCCTCTGTGTCTTCTCTAGG + Intronic
1129728430 15:77915889-77915911 GTCCCATCTGCCTTCTCCTTCGG + Intergenic
1130233147 15:82112067-82112089 GTTCTCTCTGTGTTCTACATTGG - Intergenic
1131582143 15:93654509-93654531 ATCCCCACTGTGTTGGCCCTGGG - Intergenic
1132181029 15:99752990-99753012 GTCACCTCTGTGGTGCCCCTGGG + Intergenic
1132363971 15:101242589-101242611 GTGCCCTCCGTGTACTCTCTTGG - Intronic
1132380528 15:101362911-101362933 GTCCCATCTCTGTCCTCCCCAGG - Intronic
1132584931 16:701981-702003 GTGGCCTCTGTGTCCTCCCCAGG + Intronic
1133161103 16:3912416-3912438 CTCCCCTCTGTGATGTCCATGGG + Intergenic
1133894625 16:9914639-9914661 GTTCCCACTTTGTTCTCTCTGGG - Intronic
1134017163 16:10896846-10896868 GTCCCCTCCATTTTCTTCCTTGG - Intronic
1134395013 16:13854616-13854638 GTCCCCTAGGTGTTCCCCCTGGG + Intergenic
1136270920 16:29147813-29147835 GTCCACGCTGTCTCCTCCCTGGG + Intergenic
1136381508 16:29898186-29898208 CTCCCCTCTCCCTTCTCCCTGGG + Intronic
1136984292 16:35084682-35084704 GTCCATGTTGTGTTCTCCCTTGG - Intergenic
1137727561 16:50667363-50667385 CTCCCCTCTCTGTGCTCCCAGGG + Intronic
1138088488 16:54155212-54155234 GACTCCTGTGTCTTCTCCCTAGG - Intergenic
1140084050 16:71777869-71777891 GGCCCCTCTGTCTTGGCCCTGGG - Intronic
1142027865 16:87824140-87824162 CTCCCCTCTGTGCTCTCCCAAGG + Intergenic
1142074487 16:88109515-88109537 GTCCACGCTGTCTCCTCCCTGGG + Intronic
1142074534 16:88109837-88109859 GTCCACGCTGTCTCCTCCCTGGG + Intronic
1143285297 17:5784727-5784749 GGCCCCTCTGTGTTCCCTGTAGG + Intronic
1144638040 17:16923499-16923521 GTCCCCTCTGTGGTCACCCTGGG + Intergenic
1144699003 17:17324542-17324564 GTGCCCTCTGTGTGCTCAGTGGG + Intronic
1144780440 17:17805634-17805656 GAGTCCTCTGTGTCCTCCCTGGG - Intronic
1148582363 17:48752755-48752777 GCCCCCTCCGGGTTCTCCCACGG + Intergenic
1148647922 17:49230034-49230056 GTCACCTCTGGGCACTCCCTGGG + Intronic
1149234595 17:54575124-54575146 ATCCCCTCTGCTATCTCCCTAGG + Intergenic
1149556930 17:57580101-57580123 GTCTCCTCTCTGTTCCCACTTGG + Intronic
1150455673 17:65304831-65304853 TTACCATCTGTTTTCTCCCTTGG - Intergenic
1150886329 17:69090527-69090549 GTGCCTTGTGTGTCCTCCCTTGG + Intronic
1151320296 17:73348785-73348807 GCCCCCACTGTGGTCTCCCTAGG - Intronic
1151450556 17:74195995-74196017 GTCCCCTCTGTGTCCTGCCTAGG - Intergenic
1151659024 17:75509011-75509033 GTCCCCACTGGGATCTCCATGGG + Intronic
1152214134 17:79022784-79022806 GTGTCCTCTGAGTTCCCCCTGGG + Intergenic
1153502915 18:5767297-5767319 AACCCCTCTCTGCTCTCCCTTGG + Intergenic
1153579444 18:6557529-6557551 GTCTCCTCCGTTTTCTCCTTAGG + Intronic
1153676179 18:7457557-7457579 GTGCAGGCTGTGTTCTCCCTAGG - Intergenic
1153992541 18:10413143-10413165 GTCCTCTCTGTGTTCAGGCTTGG + Intergenic
1156558044 18:38089583-38089605 TGCCCCTCTGTGTTCTCCAGCGG - Intergenic
1157551129 18:48582520-48582542 GTCCCCTCTGTGTTTCACGTGGG + Intronic
1157620849 18:49016793-49016815 GTCCCTTCTCTGTTCCCCCACGG - Intergenic
1157969275 18:52247705-52247727 GTCTCCTCTGAGTGGTCCCTGGG + Intergenic
1158242379 18:55391538-55391560 GCTCACTCTGTGTTCTCCCAGGG - Intronic
1158489281 18:57895326-57895348 GTCCCCTCAGGCTTCTCCGTGGG - Intergenic
1160486381 18:79297004-79297026 GTCGTCTCTGTCTTCTCTCTGGG - Intronic
1161696188 19:5769700-5769722 CTCCCCTCTGTGTCCTCCGCAGG - Intronic
1161738824 19:6007914-6007936 CTCCTCTCTGTGGCCTCCCTTGG - Intronic
1162962963 19:14138831-14138853 GTCACCTCTGTGGGCTCACTAGG + Intergenic
1164044849 19:21528244-21528266 GTTCCATCTGTGTTCTCCATTGG + Intronic
1164554808 19:29243307-29243329 CTACCCTCTGTGGTCTGCCTAGG - Intergenic
1164958153 19:32405041-32405063 GGCTCCTCTGTGTTCTCAGTCGG - Intergenic
1165611253 19:37155339-37155361 GTCACTTCTGTGTTCTTCTTTGG - Intronic
1167964347 19:53131606-53131628 TTCCCCTTTATTTTCTCCCTAGG + Intronic
1168093458 19:54100729-54100751 GTCACCCCTTTCTTCTCCCTGGG - Intronic
1168101672 19:54144698-54144720 CTACCCACTGTGCTCTCCCTAGG - Intronic
1168538718 19:57192606-57192628 ATGCCCTCTGGGATCTCCCTGGG - Intronic
925298014 2:2791091-2791113 GTCCCGTGTGTGTTTTCCATGGG - Intergenic
925954942 2:8954477-8954499 CTGCCCTCTGGATTCTCCCTTGG - Intronic
929008668 2:37419707-37419729 TACCCCTCAGTCTTCTCCCTGGG - Intergenic
930009667 2:46926423-46926445 GCCCCCACTGTGTGCTCCCATGG - Intronic
930206096 2:48587836-48587858 AGCCCCACTGTGTTTTCCCTGGG - Intronic
932418948 2:71590183-71590205 GGCACCTCTGTTTTTTCCCTTGG + Intronic
934692144 2:96370103-96370125 GCCCTCTCTGTGGTATCCCTGGG - Intronic
935186331 2:100736791-100736813 CTCGCCTCTGTCCTCTCCCTGGG - Intergenic
936151045 2:110022659-110022681 TTCCCCTCTGTGTTCCTCCAGGG - Intergenic
936193632 2:110348710-110348732 TTCCCCTCTGTGTTCCTCCAGGG + Intergenic
937198251 2:120179664-120179686 CTCCCCTCTGTTTTCTGCCTGGG + Intergenic
937371910 2:121304159-121304181 CTCCACTCTGTCTTCTCCCTGGG - Intergenic
938228243 2:129636180-129636202 GTCACCTCTGTGTCCTCACATGG + Intergenic
946773386 2:223112365-223112387 CTTCTCTCTGTGTTCTCCCATGG + Intronic
947097639 2:226584223-226584245 CTCCCTTCTGTTTTCTTCCTTGG - Intergenic
948188968 2:236044011-236044033 GCCCCCTCTGTCTGCTCACTGGG + Intronic
948242157 2:236446819-236446841 CTCCCCTCTGCCCTCTCCCTGGG - Intronic
948258698 2:236587006-236587028 GTACCCTCAGTGAACTCCCTAGG - Intergenic
948768248 2:240234198-240234220 GTCCCCGCGTTGCTCTCCCTGGG + Intergenic
1170435927 20:16328790-16328812 GCCCCTTCTGTGTTCTCACATGG + Intronic
1170604193 20:17863646-17863668 GTCCCTGCTGTGTGCTCCCTGGG + Intergenic
1172028579 20:31966545-31966567 TTCCCCTCTGTTTTCAGCCTTGG + Intergenic
1172951309 20:38724918-38724940 GTCCCCGCAGGGCTCTCCCTCGG - Exonic
1175619180 20:60428922-60428944 CTCCCCTCCCTGTTCTCTCTTGG - Intergenic
1176092580 20:63325647-63325669 GGCCCCTCTGTTCTCTCCCAGGG + Exonic
1176294063 21:5061251-5061273 GTCCCCTTTCTCTTCTTCCTTGG + Intergenic
1179863196 21:44202397-44202419 GTCCCCTTTCTCTTCTTCCTTGG - Intergenic
1181129427 22:20721660-20721682 GTCTCCTCTGTGTCTTCCCATGG + Intronic
1181324151 22:22032111-22032133 GCTCCCTCTTTCTTCTCCCTGGG - Intergenic
1183199318 22:36374978-36375000 CTCCCCCCTGCCTTCTCCCTGGG + Intronic
1183289124 22:36988091-36988113 CTCACCTCTGTGTTCCTCCTTGG + Intergenic
1184282747 22:43447759-43447781 GCCCCTTCTCTGTTCTCCCGAGG + Intronic
1184754190 22:46507253-46507275 GTGGCCTCTGTGCTCTCTCTGGG - Intronic
1185148980 22:49153604-49153626 GTCACCACTGTCTTCTCTCTTGG - Intergenic
950150719 3:10685141-10685163 GTCCCCACTGTTTAATCCCTGGG + Intronic
950446042 3:13039219-13039241 GGCGCCTCTGCGTTCTGCCTTGG - Intronic
951400245 3:22224572-22224594 ATCTCCACTGTGTTCTCCATGGG - Intronic
954543248 3:51410329-51410351 ATCCCCTGTGTGTGCTCTCTTGG - Intronic
959410768 3:106018211-106018233 GTGCCCTCTGTGTACTCACATGG - Intergenic
959668252 3:108945053-108945075 TTCCACTCTGTGCACTCCCTAGG + Intronic
961466338 3:127084219-127084241 GTTCTCTCTTTGTTCTCTCTGGG + Intergenic
961671095 3:128532089-128532111 GTCCCCTCTGACTTCGCACTTGG + Intergenic
963017501 3:140839836-140839858 ATGCCCTCTGCCTTCTCCCTGGG + Intergenic
963070910 3:141304444-141304466 GGCCCCTCAGGGTTGTCCCTGGG - Intergenic
963160901 3:142149711-142149733 GTTCCCCCTGTGGCCTCCCTGGG + Intergenic
964682495 3:159357958-159357980 TTCCCCTCTGTGTGCCCCTTGGG - Intronic
966556896 3:181272464-181272486 GTCTTCTCTGTGTTCTCACATGG - Intergenic
966666675 3:182479514-182479536 GTCTCCTCTTTGTTTGCCCTGGG + Intergenic
966674318 3:182568939-182568961 CTCCCCACTGGGTTCTCCCCTGG + Intergenic
966807793 3:183819994-183820016 GCCCCCTCTGAATTCTCTCTGGG - Intronic
968271183 3:197404939-197404961 GGCTCCTCTGGGATCTCCCTGGG - Intergenic
969265271 4:6060359-6060381 GTCCCCTTGGTGGTATCCCTGGG - Intronic
973013017 4:45100960-45100982 GTCCCCACTGTGTTCTATATTGG - Intergenic
973733904 4:53851171-53851193 GTCCCATCTGTTTTCACCCAGGG + Intronic
975403854 4:73967757-73967779 TGCTCCTCTGTGTTCTCCTTGGG - Intergenic
976991150 4:91368143-91368165 TTCCCTTCTATTTTCTCCCTAGG + Intronic
977737215 4:100431465-100431487 GTTCCCTCTTTGTTCTACCCAGG - Intronic
981092190 4:140743298-140743320 GTCCCATCATTGTCCTCCCTTGG - Intronic
984163996 4:176286227-176286249 CTCCCCTCTGTGTCCTCCAGAGG - Intergenic
986794341 5:11194161-11194183 GTCCCCTCTGTGTGTATCCTGGG - Intronic
987030884 5:13975509-13975531 GTCCATTCTGTCTTCTCACTTGG - Intergenic
988592315 5:32559433-32559455 GACTCCTCTGTGCTGTCCCTGGG - Intronic
991983143 5:72254417-72254439 TTCCCGTCTTTTTTCTCCCTTGG - Intronic
992524156 5:77590424-77590446 GTGCCATCTGTGTGGTCCCTTGG - Intronic
992873224 5:81026335-81026357 GCTCCCTCAGTGGTCTCCCTAGG + Intronic
994093490 5:95828398-95828420 GGTCCCTCTGTGTTCACCCTGGG + Intergenic
997738989 5:136237194-136237216 ATCACCTCTGAGTTCTACCTTGG + Intronic
999633952 5:153600628-153600650 TTCTCCTCTTTGGTCTCCCTGGG - Intronic
1000210112 5:159100589-159100611 GTCCCCTCTCCGTCCTCGCTCGG - Intergenic
1000817602 5:165943010-165943032 CTGCCCTCTGTATTCTTCCTGGG - Intergenic
1001440038 5:171735677-171735699 GTCCCATCTCTGCTCTCTCTGGG - Intergenic
1002191518 5:177480453-177480475 GTCTCTGCTGTGTTCTCTCTTGG - Intergenic
1002409448 5:179062024-179062046 GTCCACACTCTGCTCTCCCTGGG + Exonic
1005959492 6:30685561-30685583 CTCCTCTCTCTGGTCTCCCTCGG + Exonic
1011645776 6:89456465-89456487 CTTCTCTCTGTGTTCTCACTTGG + Intronic
1015440295 6:133240814-133240836 GTCCCTTCTGTCTCCTCCCTTGG + Intronic
1018951769 6:168382901-168382923 GTCCGCCCCATGTTCTCCCTGGG - Intergenic
1019413151 7:915345-915367 GTGCCCTCTGTTCTCTCCCCTGG - Intronic
1019572251 7:1718677-1718699 CTCCCATCTGTGTTCTGGCTGGG + Intronic
1019785230 7:2972643-2972665 TTCCCCTCTGTGTTCTTAGTGGG + Intronic
1019807432 7:3138283-3138305 TTCCTCTTTGTGTTCTCTCTTGG + Intergenic
1022800393 7:33771409-33771431 AACCCCTCTGTCTTCTGCCTGGG + Intergenic
1023132387 7:37015638-37015660 GTCCCCTCTGCCTTCTCCCTTGG + Intronic
1023845789 7:44119417-44119439 CTCGCCTCTGTCTGCTCCCTAGG - Intronic
1024117765 7:46209516-46209538 GTCCTCTCTGTGTCCTCACATGG + Intergenic
1024512587 7:50215347-50215369 GTCCTCTCTGAGGGCTCCCTGGG - Intergenic
1024542938 7:50493580-50493602 GTCCTCACTGTGTTCCACCTTGG + Intronic
1025804118 7:64813229-64813251 GTTTCATCTGTGTTCTCCATTGG + Intronic
1027782624 7:82538423-82538445 TTCCCCTCTGTCTTCTGCCATGG - Intergenic
1029154353 7:98504389-98504411 GTCTCCTCCTTGTTCTGCCTGGG - Intergenic
1029446027 7:100613121-100613143 GTCCCCTCTGCCTTCTGCCCCGG - Intronic
1031972802 7:128076168-128076190 GTCCCCTCCCTGTGCTCCCCTGG - Intronic
1033064898 7:138145237-138145259 GTCTCCTGTGTTTACTCCCTTGG - Intergenic
1034569909 7:151947189-151947211 GTTCCTTCTATGTTCTTCCTGGG - Intergenic
1036009887 8:4709770-4709792 TTCCCCTGTGACTTCTCCCTGGG - Intronic
1037992500 8:23330894-23330916 GTCCCCTCTGTGCTCTTCAGAGG + Intronic
1038044304 8:23753208-23753230 GTCAGCTCTGTGTTTTCTCTGGG - Intergenic
1038190283 8:25313961-25313983 CTCACCTGTGTTTTCTCCCTAGG + Intronic
1039007062 8:33051088-33051110 GTCCCTTCTGTTTCCTTCCTGGG + Intergenic
1039027123 8:33270322-33270344 GTGCCCTCTATGGTCTCCCAGGG - Intergenic
1039780401 8:40779494-40779516 GTCCCCTCTCAGCTCTCCCCAGG - Intronic
1039977957 8:42383262-42383284 ATCCCCCCTGTGCTGTCCCTGGG - Intergenic
1041942382 8:63403001-63403023 CTCTCCTCTGTGTTCTCACCTGG + Intergenic
1042271217 8:66957471-66957493 CTTCTCTCTGTGTTCTCACTTGG - Intronic
1042406780 8:68414979-68415001 GTTCACTATGTCTTCTCCCTGGG + Intronic
1043388750 8:79771005-79771027 GTATTCTCTGTCTTCTCCCTAGG - Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1046064551 8:109181151-109181173 TTCCCCTCTCTGTTCTTCCTAGG + Intergenic
1047167680 8:122458407-122458429 GTTTCCACTGTGTCCTCCCTGGG - Intergenic
1048740045 8:137546862-137546884 CTCCCCTCTGTGTTCTGTCATGG - Intergenic
1048762342 8:137808868-137808890 TTATCCTCTGTGTTCTCACTGGG - Intergenic
1049847147 8:144808348-144808370 CTGCCCTCTGTGTCCTCCCCGGG - Exonic
1050934647 9:11380047-11380069 GGACCCTCTGTGTTTTCCCAAGG + Intergenic
1053168266 9:35859883-35859905 GTCCTGTTTGTGTTCTGCCTGGG - Intergenic
1054755834 9:68956908-68956930 GTCTCCTCTGTGTTCCCCAGAGG + Intronic
1056055425 9:82817893-82817915 GCCCCCTCTATGTTCACACTGGG + Intergenic
1056534483 9:87516002-87516024 CTCTGCTTTGTGTTCTCCCTGGG - Intronic
1056860038 9:90172672-90172694 GCCCCATCTGTGTCCTGCCTGGG + Intergenic
1057138687 9:92713749-92713771 GTCCCCTGCGTGTTCATCCTGGG - Exonic
1057868380 9:98699593-98699615 GGCTCCTCTGTGGTCCCCCTAGG - Intronic
1057964862 9:99492843-99492865 CCCCACTCTGTTTTCTCCCTGGG - Intergenic
1059543327 9:115152130-115152152 TTGCCCTATGTGTTTTCCCTGGG - Intronic
1060762956 9:126271434-126271456 GGCCTCTCTGTCTGCTCCCTGGG - Intergenic
1061524151 9:131144417-131144439 GCCCCCACTGTGTTCTCCTTTGG + Exonic
1061799640 9:133106850-133106872 GTGCCCTCTGGGGACTCCCTGGG - Intronic
1187372079 X:18717776-18717798 GGCTCCTCTGGGTTCCCCCTTGG + Intronic
1189658697 X:43275448-43275470 GTTCCTTCTTTGTTCTTCCTAGG - Intergenic
1190438254 X:50449195-50449217 CTCCCCTCTGACTACTCCCTGGG - Intronic
1190845771 X:54188977-54188999 GGCCCATCTGTATTATCCCTGGG + Intergenic
1191890212 X:65931961-65931983 GTCCTCTCTGGCTGCTCCCTCGG + Intergenic
1192344528 X:70290118-70290140 GTCCCTTCCCCGTTCTCCCTGGG - Exonic
1194169174 X:90560781-90560803 TTCCCCTCTGTGTTTTCAATTGG + Intergenic
1194666704 X:96684547-96684569 GTTCCCTCCCTGTTCTCGCTGGG + Intergenic
1195511202 X:105717269-105717291 GTCACCTCTGAGTTTTCCTTTGG + Intronic
1196941393 X:120779682-120779704 CTTTCCTCAGTGTTCTCCCTTGG - Intergenic
1199894166 X:152116130-152116152 GTCCCCTCTGTGCTCACACAGGG + Intergenic
1199952438 X:152716508-152716530 GTCCCCTCTGTGCTCACTCAGGG - Intronic
1199957245 X:152751940-152751962 GTCCCCTCTGTGCTCACTCAGGG + Intronic
1200515417 Y:4138566-4138588 TTCCCCTCTGTGTTTTCAATTGG + Intergenic