ID: 1117982726

View in Genome Browser
Species Human (GRCh38)
Location 14:61357930-61357952
Sequence TCTGGTCACCAGGCAGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117982726_1117982730 27 Left 1117982726 14:61357930-61357952 CCTTGCACTGCCTGGTGACCAGA 0: 1
1: 0
2: 1
3: 21
4: 240
Right 1117982730 14:61357980-61358002 AAAGCCTCCTTAAATTTTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117982726 Original CRISPR TCTGGTCACCAGGCAGTGCA AGG (reversed) Intronic
900142213 1:1143422-1143444 GCGAGTCCCCAGGCAGTGCAGGG - Intergenic
900165889 1:1244160-1244182 TCTGGTCTCTGGGCAGTGCAGGG + Intronic
901758234 1:11454303-11454325 TCTGGTCCCCAGGCTGGGGAAGG + Intergenic
902271848 1:15310397-15310419 TCTGGGCACCAGGCATCCCAGGG + Intronic
904307991 1:29602659-29602681 TGTGGTGAACAGGCAGTGAAAGG + Intergenic
904410930 1:30324548-30324570 TGTGGAGACCAGGCAGAGCAGGG + Intergenic
904599221 1:31664657-31664679 CCTTGTCACCAGGCAGGACACGG + Intronic
904697427 1:32338134-32338156 TCTGATCCCCAGGCACTGCCTGG + Intergenic
905252280 1:36657313-36657335 ACTGGCCTCCAGGCAGGGCATGG + Intergenic
905492463 1:38355210-38355232 TCTGGCAACAATGCAGTGCATGG + Intergenic
905862185 1:41359344-41359366 TGTGGACACCGGGCAGGGCAGGG + Intergenic
905906316 1:41620863-41620885 ACTGTGCACCAGGCAGTGCTGGG + Intronic
906276279 1:44518518-44518540 ACAGGCCATCAGGCAGTGCATGG + Intronic
907403390 1:54239469-54239491 TCTGGTCCCCAGACACTGCCTGG + Intronic
907607282 1:55830581-55830603 TCTTGAAACCAGGCAGTGCTTGG + Intergenic
908387045 1:63652754-63652776 TCTGGGGAGCAGGCAGTGAATGG + Intronic
911358710 1:96850864-96850886 TCAGGGCACCAGGGAGTTCAAGG - Intergenic
912170980 1:107098776-107098798 CAGGGTCACCAGGCAGTGCAGGG - Intergenic
912755204 1:112318762-112318784 TCCAGTCACCAGGCAGTAAATGG - Intergenic
914922237 1:151854874-151854896 TCATGTCAGCAGGCAGTGCTGGG + Intergenic
916354429 1:163888887-163888909 TCTGATCCACAGGCAGTGGAGGG - Intergenic
920702390 1:208227631-208227653 TTTGGTAACCAGGCAGTGCTGGG + Intronic
922003707 1:221506237-221506259 TATGGTCACCAGACTGTCCAAGG + Intergenic
922174731 1:223188678-223188700 TCCTGTCAGCAGGCAGTGTAGGG + Intergenic
923343729 1:233031118-233031140 ATTGGACAACAGGCAGTGCAGGG - Intronic
1063113574 10:3057022-3057044 TCAGGTCCACAGGCAGTGGAAGG + Intergenic
1065602530 10:27384322-27384344 TCAGGTCAAGAGGCAGGGCAGGG - Intergenic
1067730349 10:48806082-48806104 TCTTCTCACCAGGCAGGGAAGGG - Exonic
1069312619 10:67057342-67057364 TATAGTCACCATGCTGTGCATGG + Intronic
1069694038 10:70373883-70373905 TATGGCTCCCAGGCAGTGCAGGG + Intronic
1070290173 10:75108812-75108834 TATGGCCACCAGGGAGAGCAGGG - Intronic
1070530507 10:77332639-77332661 TGGGGTCACCAGGCAGAGCTAGG + Intronic
1070686688 10:78490046-78490068 GCTGGTCACCAGAAAGTCCAAGG + Intergenic
1070895883 10:79982538-79982560 GCTGATCACCAGGCATTGCATGG - Intronic
1072547196 10:96448826-96448848 TGAGGTCAGCAGGCAGTGGAGGG + Intronic
1072683750 10:97524824-97524846 TCTGGGCTCCAGCCAGTGGAGGG + Intronic
1073339799 10:102735963-102735985 TCTGGACAGCAGGCAGATCAGGG - Intronic
1074438039 10:113451260-113451282 TCTGATCAGCAGGCAGTGCATGG + Intergenic
1076540737 10:131213169-131213191 TCTGGTCACCAGGCAGCCATGGG - Intronic
1076569651 10:131424289-131424311 ACTGGACAACAGGCAGGGCAAGG - Intergenic
1077281229 11:1747145-1747167 TCTGGTCTCCACGCAGGGCTTGG + Intronic
1077572308 11:3350261-3350283 TCTGGCCAGCAGACAGTGCACGG + Intronic
1078516380 11:12026186-12026208 TCTGGTCACCAGAAAGGCCAAGG - Intergenic
1078920659 11:15827135-15827157 GCAGGTCACCAGGAAGAGCATGG + Intergenic
1078933235 11:15929349-15929371 TCTAAACATCAGGCAGTGCATGG + Intergenic
1079118320 11:17655183-17655205 CGTGGGCAACAGGCAGTGCAAGG + Intergenic
1080289682 11:30656697-30656719 TCTGGAAACCAGGTAGTACAAGG + Intergenic
1081787560 11:45757926-45757948 TCTGGACACCATGGAGTCCAGGG + Intergenic
1085464564 11:76715125-76715147 TCCGCTCACCAGGCTGTGCCTGG - Intergenic
1090161285 11:124498302-124498324 TCAGGTCACCAACCAGTGTAGGG - Intergenic
1090401205 11:126449382-126449404 TGTGGTCACCAGGCAGTCAGTGG + Intronic
1090544078 11:127743432-127743454 TCTCCTCTCGAGGCAGTGCAGGG + Intergenic
1090556171 11:127878739-127878761 GCTGGTCACCAGGAAGACCAAGG - Intergenic
1091815383 12:3433892-3433914 TCTTGTCACTAGGCTGGGCATGG - Intronic
1091986834 12:4916544-4916566 TCAAGTCTCCAGGGAGTGCAAGG - Exonic
1092934435 12:13347481-13347503 TATGCTCACCAGGCAGTGGGAGG - Intergenic
1095469927 12:42525631-42525653 TCTGGTCACCAGGAAGTGTGTGG - Intronic
1095940695 12:47724946-47724968 ACCTGTCACCAGGCAGTGGAAGG + Intronic
1095986939 12:48005059-48005081 TCTGGGGACCAGGTACTGCAGGG - Intergenic
1096414852 12:51404192-51404214 TATGCTCACCAGGCAGCCCAGGG - Intronic
1096668708 12:53184845-53184867 TCAGGTCACCTGGCAGGGCAGGG - Intronic
1097887470 12:64743377-64743399 TCTGGTGAGCAGACAGTACAGGG + Intronic
1099743483 12:86670755-86670777 TATGGTCACCAGACTGTCCAAGG + Intronic
1102843537 12:116152545-116152567 TCTGGTCTTCTGACAGTGCAGGG - Intronic
1102872255 12:116423145-116423167 TCTGGTCATCAGGAAGACCAGGG + Intergenic
1103042299 12:117705598-117705620 ACCTGTCACCAGGCAGTGCAAGG - Intronic
1104206804 12:126646925-126646947 TGTGGTCTCCAGGCATTGCAGGG - Intergenic
1104730918 12:131104889-131104911 CGTGGCCACCAGGCAGAGCACGG - Exonic
1104736826 12:131140143-131140165 CCTGGACACCAGGCACTGCGGGG - Exonic
1111143498 13:84153094-84153116 TATAGTCACCAGGCTGTTCAAGG - Intergenic
1113801975 13:113091466-113091488 GCTGGTCACCTGGCCGTGCTGGG + Intronic
1114077515 14:19168973-19168995 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1114588611 14:23838080-23838102 CCTGGTCACCAGGAAGATCAAGG - Intergenic
1115358767 14:32478015-32478037 TCCTGTCAACAGGCATTGCATGG + Intronic
1117257619 14:53994946-53994968 TATGGTCACCAGCTAGTACATGG + Intergenic
1117982726 14:61357930-61357952 TCTGGTCACCAGGCAGTGCAAGG - Intronic
1119760353 14:77146469-77146491 CCTGGACACCTGGCATTGCAGGG - Intronic
1121323451 14:93006304-93006326 TCTGTTCACCAGGGAGGGGATGG - Intronic
1121927942 14:97946347-97946369 TCTCATCACAAGGCAGAGCAGGG + Intronic
1122355551 14:101121033-101121055 GAGGGTCACCAGGAAGTGCACGG - Intergenic
1123795372 15:23765534-23765556 TCTGGTCCCCAGGCAAGGAAGGG + Intergenic
1124580036 15:30945481-30945503 TCTGGGGACTGGGCAGTGCATGG - Intronic
1124796563 15:32786812-32786834 TCAGGCCACCAGGCAGTGGTTGG - Intronic
1126202850 15:46007133-46007155 GCTGGTCACCAGGAAGACCAAGG - Intergenic
1126873510 15:53013597-53013619 TTTGGTAACCAGGCATAGCAGGG + Intergenic
1128321315 15:66696651-66696673 TCAGTTCACAAGGCAGTTCAAGG + Intergenic
1128365071 15:66993919-66993941 TCTGGTCATGGGGCAGTCCATGG + Intergenic
1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG + Intronic
1129763514 15:78146439-78146461 TCTGGGCACTACACAGTGCAAGG + Intronic
1132229509 15:100171221-100171243 TCTGGGCAGCAGACAGTGCAAGG + Intronic
1132400467 15:101501960-101501982 CCTGGTCACCAGGGAGTCCTCGG - Intronic
1133154026 16:3859562-3859584 GCTGGTCACCAGGAAGACCAAGG + Intronic
1134827291 16:17294823-17294845 CCTGGTGTCCAGACAGTGCATGG + Intronic
1135601011 16:23783431-23783453 TGTGTTGAGCAGGCAGTGCATGG + Intergenic
1135988642 16:27203484-27203506 TCTGATCACGACGCAGTGCCTGG - Intronic
1136278420 16:29192770-29192792 GGGGGGCACCAGGCAGTGCAGGG + Intergenic
1136651906 16:31680234-31680256 TCTGGTCACCAGGTGTTGCTTGG - Intergenic
1137903354 16:52293382-52293404 TGAGGTCACCAGGAAGTGGATGG + Intergenic
1141987436 16:87589081-87589103 TATGGAGACCAGGCAGTGAAAGG - Intergenic
1142204013 16:88774093-88774115 ACCGGTCACCAGGCAGGGCTGGG + Intronic
1142227145 16:88883066-88883088 TGTGGTCACCAGGCAGGGAGCGG + Intronic
1142266185 16:89064986-89065008 TCGGGCCACCAGACAGAGCAGGG - Intergenic
1142858834 17:2749197-2749219 TCTGGACGCCCGGCAGTGCCAGG + Intergenic
1142969848 17:3603986-3604008 TCTTGACACTAGGCAGGGCAGGG + Intergenic
1143758112 17:9081238-9081260 TCTGGTCACCAAGAAGTGTGAGG - Intronic
1144017641 17:11211670-11211692 TCTGGACTCCAGGCATTACAAGG - Intergenic
1145731821 17:27196105-27196127 TCACATCACCAGGCAGTTCACGG - Intergenic
1145887872 17:28395561-28395583 GCTGGTCACCAGGGAGACCAGGG - Exonic
1147355305 17:39891052-39891074 GCTAGCCACCAGGCACTGCAGGG + Intergenic
1147385157 17:40076863-40076885 TCTGGTGACCTGGCACTGGATGG - Exonic
1148699539 17:49579365-49579387 TCTGGACACCGGGCAGGGAAGGG + Exonic
1148822585 17:50368172-50368194 TCTGATCACCAGGCTGCCCAAGG - Exonic
1149866712 17:60155083-60155105 TCTGTTCCCCAGGCAGGGCCAGG - Intronic
1150098339 17:62399024-62399046 GCTGTTCAGCAGGCAGAGCAGGG - Intronic
1152516997 17:80831236-80831258 CCTGGTCTCTGGGCAGTGCAAGG - Intronic
1152615029 17:81334018-81334040 TCTGGCCATCAGGCAGTCCGTGG + Intergenic
1156368221 18:36448875-36448897 TTTGGTCACAAGAGAGTGCAAGG - Intronic
1156496495 18:37529221-37529243 TCTGGTCCTCAGGAAGTGCTTGG + Intronic
1160236509 18:77090076-77090098 TCTGCTGACCAGGGAGAGCAAGG - Intronic
1161614107 19:5260580-5260602 TCAGGTCACCTGGCTGTGGAAGG - Intronic
1163186032 19:15640386-15640408 TCTTGCCTCCAGGCAGTCCAGGG - Intronic
1164593820 19:29520672-29520694 TCTTGTCTCCATGCAATGCAGGG + Intergenic
1164602022 19:29568585-29568607 CCTCATCACCAGGCAGAGCAGGG - Intergenic
1165093477 19:33398182-33398204 CTTGGTCAGCAGGCAGTGCCGGG - Intronic
925417573 2:3681775-3681797 TCTGCACACCTGGCTGTGCAAGG + Intronic
926345881 2:11944450-11944472 GCTGGTCAACAGGCAGTGGGTGG + Intergenic
927410633 2:22821211-22821233 TCTGGTCACCAAGAAGTGGGTGG - Intergenic
928170668 2:29001071-29001093 TCTGGCCCCCGGGCAGTGCTGGG + Intronic
928421366 2:31139560-31139582 TCTGCTCCCCAGACAGAGCAAGG - Intronic
929967811 2:46548643-46548665 TCTGCTCACCGGGCTGAGCAAGG - Intronic
931969799 2:67573429-67573451 TCTGTCCACCAGGCAGGTCAAGG + Intergenic
935155928 2:100483552-100483574 GCTGGTCACCAGGAAGACCAAGG + Intergenic
935610731 2:105022482-105022504 TCTAGTCACCAGGCACTGTTTGG + Intergenic
935738781 2:106128245-106128267 TCTGGTCACCAGACAGAACAGGG - Intronic
936115549 2:109699954-109699976 ACTGAGCAACAGGCAGTGCAAGG - Intergenic
938083949 2:128386061-128386083 TCAGGGCACCAGACATTGCAAGG + Intergenic
938491965 2:131765777-131765799 TCTGGTAACCAGGCCAGGCACGG + Intronic
938495601 2:131796565-131796587 TCTGGTAACCAGGCCAGGCACGG - Intronic
941542682 2:166806058-166806080 TATGGACATCAGGCAGTGCAAGG - Intergenic
943311758 2:186334235-186334257 TCTGGTCACCAAGAAGTGTGGGG - Intergenic
945650279 2:212550124-212550146 TCTAGTAACCAGAGAGTGCAGGG - Intergenic
945951321 2:216041658-216041680 GCTGGTCACCAGACAGACCAAGG + Intronic
1172334409 20:34102075-34102097 CCTGGTCATCAGGCAAGGCACGG - Intronic
1172571393 20:35973697-35973719 CCTGGTCACCAGGCCAGGCACGG - Intronic
1175240940 20:57548312-57548334 TCTGGTCTCCAGGATCTGCACGG + Intergenic
1175720868 20:61286233-61286255 GCTGGACAGGAGGCAGTGCAGGG + Intronic
1176615923 21:9028397-9028419 TCTGGTAACCAGGCCAGGCACGG - Intergenic
1176709227 21:10135331-10135353 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1178473879 21:32919460-32919482 TCTGGTACCCAGGCAGTAGAAGG + Intergenic
1178639779 21:34336589-34336611 TCTGGTCATCAGACAATGGAAGG - Intergenic
1179303382 21:40132939-40132961 TCTGTTCCCCAAGCAGTACAGGG - Intronic
1179418927 21:41220413-41220435 GCTGGTCACCAGAAAGAGCAAGG - Intronic
1179795865 21:43783087-43783109 TGTGGGCACCAGGCGCTGCAGGG + Intergenic
1180222851 21:46370287-46370309 TCTGGTCTGCAGGCAGTGAGTGG + Intronic
1180226339 21:46394832-46394854 TCTGGTCTCCAGGGAGGGCCTGG + Intronic
1180229926 21:46421189-46421211 TCTGCTCAGCAGGCTGTGCCGGG + Intronic
1180713273 22:17854509-17854531 CCTGTTCACCAGGCAGTTCTCGG - Intronic
1181691849 22:24567233-24567255 TCTGAGTGCCAGGCAGTGCAGGG + Intronic
1182065843 22:27431127-27431149 TGAGGTCACCAGCCAGTGAAAGG - Intergenic
1182163231 22:28144848-28144870 TCTGGGCACAAAGCACTGCAAGG + Intronic
1183248339 22:36710953-36710975 CCTGGTCACCAGGCCATGCAGGG - Intergenic
1183954630 22:41372014-41372036 TCTGGTTCCCAGGCTGTGCATGG - Intronic
1184701668 22:46178393-46178415 GCTGGACATCAGGCAGTGAAGGG + Intronic
1184816135 22:46872536-46872558 GTTGGACAACAGGCAGTGCAGGG + Intronic
1185017475 22:48353157-48353179 TCTGCTCCCCGGGCAGTGCCTGG + Intergenic
1185355470 22:50366925-50366947 ACTGGACGCCAGGCAGTGAAGGG - Intronic
949695751 3:6693032-6693054 TATGGACATCAGACAGTGCAGGG + Intergenic
951547377 3:23840896-23840918 ACTGGACATCAGGTAGTGCAAGG - Intronic
952656466 3:35792399-35792421 TCTGGTCAACAGGGATTCCAAGG + Exonic
953040743 3:39252965-39252987 GGCGGTCACCAGGCAGTGCTGGG + Intergenic
953133372 3:40161914-40161936 TGTGGTCACCATGAACTGCATGG + Intronic
953222938 3:40989779-40989801 TCTGGTCACTTGCCAGAGCAAGG - Intergenic
953879269 3:46683277-46683299 GCTGTTCACCAGGCCCTGCATGG - Exonic
954622284 3:52003042-52003064 TCTGCTCACCAAGCAGTCCTGGG + Intergenic
955666630 3:61355982-61356004 CCTGGCCACCAAGCAGAGCAGGG + Intergenic
955721187 3:61883239-61883261 TTTGGTCAGAAGACAGTGCATGG - Intronic
956485919 3:69721899-69721921 TCTGGTCACCAAGAAGTGTGTGG - Intergenic
958823813 3:99006406-99006428 TATGGTCACCAGACTGTCCAAGG - Intergenic
961053334 3:123766307-123766329 TGTGGTCACGAGGCAGAGAAGGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961167820 3:124775861-124775883 TCTGGGCACCAGAGAGTGGACGG - Intronic
961435293 3:126912606-126912628 TAAGCTCACCAGGCAGTGGAGGG + Intronic
961785917 3:129346740-129346762 TCTGGTCACCCTGCTGTGCACGG - Intergenic
967824574 3:193868200-193868222 TCTTGCCACCAGGCAGTGCCCGG - Intergenic
968540697 4:1166884-1166906 TCTGGGCCCCGTGCAGTGCAGGG - Intergenic
969329701 4:6467020-6467042 CCAGGGCACCAGGCAGTGCAGGG + Intronic
970087461 4:12365421-12365443 TCTGCTCGCCAGGCTGTGCTAGG + Intergenic
970704228 4:18781425-18781447 ACTGGTGAGCAGGCAGTCCAAGG - Intergenic
974146667 4:57956345-57956367 GCTGGGAACCAGGCAGTTCAGGG + Intergenic
975608760 4:76183202-76183224 TCTGGTCACCAAGAAGTGTGTGG + Intronic
977736241 4:100419896-100419918 CCTGCTCACCATGCATTGCATGG - Intronic
978535507 4:109757553-109757575 TTTGGTCAGCAGGCTGTGGATGG + Intronic
978882166 4:113718621-113718643 TCTAGTCCCCAGGCAGGGAAGGG + Intronic
981231112 4:142356801-142356823 GCTGGTCACCAGGAAGACCAAGG + Intronic
985033904 4:185819666-185819688 GCTGGTCACCTGTCAGTGCAGGG + Intronic
986363136 5:7001568-7001590 ACTGGACACCAGTCAGTGCTAGG + Intergenic
990312608 5:54554044-54554066 CCTGGTGAGCAGGCAGAGCATGG - Intergenic
995131896 5:108639466-108639488 GTAGGTCACCAGGCACTGCAGGG - Intergenic
997614594 5:135237679-135237701 TCTGGTCCCCAGCCTGTGCCTGG + Intronic
999249825 5:150175962-150175984 TCTGTTCCCCAGGCAGGGGAAGG + Intronic
1001875061 5:175193043-175193065 TCTGGTCACCAGGCAAAGGGAGG + Intergenic
1003254289 6:4460632-4460654 TCTGATCACCAGGCAGTCTAAGG - Intergenic
1003639138 6:7862004-7862026 TCTGTCCACCAGGGAGGGCAGGG + Intronic
1004054775 6:12124349-12124371 TCTGGTGGCTAGGCGGTGCATGG - Exonic
1005458894 6:26048815-26048837 TCTGGTCCCCAGGCAGGAAAGGG - Intergenic
1007383040 6:41502952-41502974 CCAGGCCACCAGGCAGTGCCAGG + Intergenic
1008280174 6:49587027-49587049 TCTGGTCACCAAGAAGTGTGTGG - Intergenic
1014824407 6:126032215-126032237 TCTGGCCACCATGTAGGGCATGG - Intronic
1019158057 6:170052045-170052067 TCTGGGCAGCAGGCAGCACAGGG - Intergenic
1019518676 7:1450851-1450873 TCTGTTCACCCTGCAGTGAAGGG + Intronic
1019546700 7:1581010-1581032 TCTGGTGTCAGGGCAGTGCATGG + Intergenic
1022821606 7:33967736-33967758 GCTGGTCAAGAGGCAGGGCATGG - Intronic
1024033179 7:45482576-45482598 TTAGGCCACCAGGCAATGCATGG - Intergenic
1025249806 7:57344207-57344229 AAGGGTTACCAGGCAGTGCATGG - Intergenic
1028465817 7:91150169-91150191 TCTGGTCAGGAGGAAGTGGAAGG + Intronic
1029566384 7:101341131-101341153 TCTGTTGCCCAGGCAGTACAGGG + Intergenic
1031841559 7:126747159-126747181 TCTTGTAACCAGGCATTCCAAGG - Intronic
1031857183 7:126937078-126937100 TCTGTTCCCCAAGCAGTACAAGG + Intronic
1031861568 7:126985641-126985663 TGGGGTCTCAAGGCAGTGCAGGG + Intronic
1031967809 7:128040405-128040427 TCTGGTCATCAAACAGAGCAAGG + Intronic
1032530908 7:132619028-132619050 TCTAGTTACCAGGCAGTGTCTGG - Intronic
1037389719 8:18380750-18380772 GCTGGTCACCACGGAATGCAGGG - Intergenic
1037534407 8:19811405-19811427 ACGGGTCCCAAGGCAGTGCAGGG + Intergenic
1038485423 8:27931697-27931719 TCTGTCACCCAGGCAGTGCAGGG + Intronic
1043795828 8:84537493-84537515 TCTGTTCACAAGGCTGTGGAGGG + Intronic
1046566767 8:115911814-115911836 TCTGGTCAACAGCCATTGCTGGG - Intergenic
1048333039 8:133484127-133484149 TCTGTTCACCACCCAGTGAATGG - Intronic
1048700376 8:137082017-137082039 TCTGGTTACCAGGGGATGCAAGG - Intergenic
1049351515 8:142167222-142167244 TCTGGGCACAAGGCAGAGCAGGG - Intergenic
1049820099 8:144628188-144628210 GGTGGTCACCATGCAGGGCAGGG + Intergenic
1050206179 9:3198808-3198830 TCTGGTGACCAGCCAGAGCCTGG + Intergenic
1052563833 9:30120802-30120824 TCAGGTTACCAGACACTGCAAGG + Intergenic
1053646197 9:40120859-40120881 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1053759519 9:41342681-41342703 TCTGGTAACCAGGCCAGGCACGG - Intergenic
1054327209 9:63718756-63718778 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1054538373 9:66255117-66255139 TCTGGTAACCAGGCCAGGCACGG - Intergenic
1057469518 9:95344986-95345008 TCTGGTCACCAGAAAGACCAAGG - Intergenic
1057695245 9:97318451-97318473 TCTGGCCACCAGTGAGTTCATGG + Exonic
1058047741 9:100375134-100375156 TCTGGTTAACAGGCTGGGCACGG + Intergenic
1058112415 9:101045676-101045698 TATGTCCACAAGGCAGTGCAAGG - Intronic
1059253278 9:112906315-112906337 TCTGGTCCCCAGGCAAGACAGGG - Intergenic
1059323316 9:113485992-113486014 TGGGGACACCAGGCACTGCATGG + Intronic
1059516167 9:114897692-114897714 TCTGGTGGCTAGGCAGAGCATGG + Intronic
1059708829 9:116848727-116848749 TCTGGTCACCAAGAAGTGTGTGG + Intronic
1060817646 9:126643694-126643716 TCTGGTCACCTGTCAGTACAGGG + Intronic
1061366462 9:130174460-130174482 GCTAGTGACCAGGCAGTGCCAGG + Intronic
1061372710 9:130206811-130206833 TCAGGGCAACAGGCAGTGTAGGG + Intronic
1061806598 9:133140633-133140655 TGTGCCCACCATGCAGTGCAGGG + Intronic
1062013945 9:134281921-134281943 TCTGGTGGCCAGGCAGTGAGTGG + Intergenic
1062279898 9:135747215-135747237 TCTGGTCACCGTGAAGGGCATGG + Intronic
1062339482 9:136087601-136087623 TCTGGTCACCAGGAAGGTCTAGG - Intronic
1062369250 9:136228729-136228751 TCCGGTCACAAGGCTGTGCCAGG - Intronic
1062616138 9:137396856-137396878 TCTGGGCAACAGGCAGTGTGAGG + Intronic
1202793987 9_KI270719v1_random:104301-104323 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1187137060 X:16558260-16558282 CCTGGTCACCAGGTAGAGGAGGG - Intergenic
1188985443 X:36764699-36764721 TAAGTTCACCAGGAAGTGCATGG - Intergenic
1189720999 X:43917532-43917554 ACTGGACATCAGGCTGTGCAGGG - Intergenic
1190378308 X:49813106-49813128 TTTGGACACCAGGCCGGGCATGG + Intergenic
1192222360 X:69206125-69206147 CCTGGTAAACAGGCAGGGCAAGG + Intergenic
1192259462 X:69495828-69495850 TCTGCTTCCCAGGCAGGGCAAGG - Intergenic
1194333789 X:92618767-92618789 TCTGTTGATCAGGGAGTGCAAGG + Exonic
1200642472 Y:5737769-5737791 TCTGTTGATCAGGGAGTGCAAGG + Intronic
1201304848 Y:12541675-12541697 TCTGGTCTCCAGTCGCTGCAGGG - Intergenic