ID: 1117982851

View in Genome Browser
Species Human (GRCh38)
Location 14:61358872-61358894
Sequence GGAGTTACTAAGTCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117982851_1117982855 16 Left 1117982851 14:61358872-61358894 CCTGCTTTTGACTTAGTAACTCC 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1117982855 14:61358911-61358933 GCTCAGCTATCACCTCCTCCAGG 0: 2
1: 10
2: 32
3: 195
4: 769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117982851 Original CRISPR GGAGTTACTAAGTCAAAAGC AGG (reversed) Intronic
906137065 1:43507093-43507115 GGGGTTACTAACTCAAGACCTGG + Intergenic
907916094 1:58871309-58871331 GGAGTTACATAAGCAAAAGCTGG - Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
909102154 1:71361673-71361695 GGAGATATTCAGGCAAAAGCTGG - Intergenic
909779181 1:79521314-79521336 GGAGTTACTAAGCTGAAGGCGGG + Intergenic
912580321 1:110715138-110715160 GGATTTACACAGTCTAAAGCTGG + Intergenic
916287356 1:163123635-163123657 GGAATTTCTAAGTCAAAGGAGGG - Intronic
919168920 1:193929231-193929253 GTAGTTACTCAGACATAAGCAGG - Intergenic
919194632 1:194267347-194267369 GCAGTCAGTAAATCAAAAGCTGG + Intergenic
919258922 1:195163655-195163677 GCAGTTATTAAGGCAAAAGCTGG - Intergenic
1065253010 10:23836007-23836029 GAAGTTACTAAGTTAAAATGGGG + Intronic
1067297500 10:44983217-44983239 GGAGTTACTACTGCAGAAGCAGG - Intronic
1068045478 10:51881009-51881031 GGAGTTACTTAGAGAAAAGGGGG + Intronic
1068056043 10:52013979-52014001 GGAGTAACTAAGGAAAAAGCAGG - Intronic
1068735313 10:60407651-60407673 GGAATTACAAAGTCATAAGATGG - Intronic
1070937724 10:80314299-80314321 GTGGTTACAAAGTCAAACGCAGG - Intergenic
1071781393 10:88849792-88849814 GGAGTTACTTATTCAAAATTAGG + Intronic
1072067490 10:91885091-91885113 GGAATTACTAAGGCAAAGGGAGG - Intergenic
1075276341 10:121096336-121096358 AGAGATTCTAAGCCAAAAGCAGG - Intergenic
1080687561 11:34527913-34527935 GGATGTACTAGGTCAAAAACAGG - Intergenic
1080846657 11:36032852-36032874 GGAGAAACTAAGGCAAAGGCAGG - Intronic
1090001527 11:122964492-122964514 GAAGTTCCTAAGTAAAAATCAGG + Intergenic
1091418772 12:315931-315953 GGAGTTACTCAGTATAAAGAAGG + Intronic
1094022166 12:25926101-25926123 GGAGAATCTAAGTGAAAAGCAGG - Intergenic
1094045986 12:26167698-26167720 TGAGTTACTAAGTCACATGAAGG - Intronic
1097390645 12:59008278-59008300 GGAGTTATTCATACAAAAGCAGG - Intergenic
1099029843 12:77512531-77512553 TGAGTTACTTAGCAAAAAGCAGG + Intergenic
1099712031 12:86240247-86240269 AGAGTTACACAGTGAAAAGCAGG + Intronic
1099816454 12:87655033-87655055 GGAGTTACAAAGTTCAAAGATGG - Intergenic
1102872674 12:116426349-116426371 GGAGTTTTTAAGGCAGAAGCCGG + Intergenic
1108488148 13:50949374-50949396 GGACTTACTAAGTCTTAAGTTGG + Intronic
1108539149 13:51420936-51420958 GGTTCTACTAACTCAAAAGCTGG + Intronic
1109858120 13:68160379-68160401 TGAGTTACTAAGTCACACACTGG + Intergenic
1110728224 13:78850845-78850867 GGAGTTAATGAGTCCAAGGCTGG - Intergenic
1111334874 13:86807255-86807277 GGAGGTAAAAAGTCAAAAGCAGG - Intergenic
1111906101 13:94257816-94257838 TGAGAAACTAAGTCAAAAACAGG + Intronic
1114131398 14:19797339-19797361 GGAGGTACTCAGTGAAAAACAGG - Intronic
1117269847 14:54132142-54132164 GGAGTTGGTCAGTCAAAAGTTGG - Intergenic
1117666077 14:58057500-58057522 GGTGTTACTAGCTCAAAAGGTGG + Intronic
1117982851 14:61358872-61358894 GGAGTTACTAAGTCAAAAGCAGG - Intronic
1118463447 14:66008828-66008850 GGAGGAACTAAGTCATCAGCAGG - Intergenic
1121896874 14:97657092-97657114 GGAGTGGCTAAGTCAGAAGAAGG + Intergenic
1122160691 14:99781884-99781906 GGAGTCCAGAAGTCAAAAGCGGG - Intronic
1123611075 15:22095518-22095540 GGAGGTACTCAGTGAAAAACAGG - Exonic
1125896004 15:43302189-43302211 GGAGGTGCTAAGTCAAGAGAGGG - Intronic
1126316705 15:47377663-47377685 GGAGTGGCTGAGTCAGAAGCAGG + Intronic
1129793951 15:78361969-78361991 CGGGTTTCTAAGTCAAGAGCTGG + Intergenic
1202983323 15_KI270727v1_random:387274-387296 GGAGGTACTCAGTGAAAAACAGG - Intergenic
1134863902 16:17587211-17587233 GCAGCCACTAACTCAAAAGCTGG + Intergenic
1139065797 16:63312498-63312520 GGGGATAGGAAGTCAAAAGCTGG + Intergenic
1140872368 16:79119045-79119067 GGAATTACTAGGTCAAAGGTTGG + Intronic
1147702779 17:42406271-42406293 GGAGTGTCTAAGTTGAAAGCGGG + Intronic
1150013768 17:61532396-61532418 GGAGTTATTCTGTCAAAAGTGGG - Intergenic
1152678022 17:81651522-81651544 GGGGTCCCTAAGTGAAAAGCAGG + Intronic
1152970353 18:155637-155659 AGAGTTACTAAAGAAAAAGCTGG + Intergenic
1153374972 18:4365869-4365891 TAAGGTATTAAGTCAAAAGCTGG + Intronic
1156782841 18:40871565-40871587 GGACTTACTAACTCAATTGCAGG - Intergenic
1157509948 18:48263898-48263920 GGAGTTAATAAATCAAATGCTGG + Intronic
1162537085 19:11269134-11269156 TAAGTTACAAAGACAAAAGCTGG + Intergenic
1164818720 19:31227344-31227366 AGAGTTACTGAGTCAAAAGTGGG + Intergenic
925645593 2:6032697-6032719 GGAGTTACAAAATCAGAAACAGG + Intergenic
925697772 2:6599446-6599468 GGAGATAGTAAGACAAAAGCGGG + Intergenic
926172962 2:10564906-10564928 GGAGTCACTAAGTACAAAGTAGG - Intergenic
930929466 2:56862671-56862693 GGAGTTACTTAGGCACAAGAAGG + Intergenic
932515092 2:72338110-72338132 AGAGCTACTAAGTGGAAAGCTGG - Intronic
934095984 2:88604410-88604432 GGAGTTACTGAGGCAAGAGATGG - Intronic
934902006 2:98167011-98167033 AGAGTTACTGAGGCAAAGGCTGG + Intronic
934995868 2:98959345-98959367 GCATTTACTCAGACAAAAGCAGG - Intergenic
935496585 2:103789561-103789583 GCAGATTCTAAGCCAAAAGCTGG - Intergenic
939115433 2:138055264-138055286 GGTTTTACAAAGTAAAAAGCAGG - Intergenic
1177724685 21:24951553-24951575 GAATCTACTTAGTCAAAAGCAGG + Intergenic
1179596676 21:42447348-42447370 GGAGTTACAAAGGCGAAAGCCGG - Exonic
1180015993 21:45084363-45084385 ACAGTTACTGAGTCAAAAGAAGG - Intronic
1180047761 21:45317748-45317770 TGAATTTCTAAGACAAAAGCTGG - Intergenic
949130846 3:498783-498805 GGAGTTAGTAATTAGAAAGCAGG + Intergenic
949775346 3:7626332-7626354 AGAGTTACTCAGTCACAGGCTGG + Intronic
957550005 3:81691893-81691915 AGAGTTACTAAGTCAGAAGTGGG - Intronic
958807524 3:98829772-98829794 GGGGTTACTAGGTCAAATGGTGG + Intronic
962636034 3:137332276-137332298 GGAGGTACAAAGTCACAAGGTGG - Intergenic
962985209 3:140530047-140530069 GGAATTACTGGGTCAAAGGCTGG - Intronic
965800529 3:172488864-172488886 GGAGTTACTAATTCAAAGGAAGG - Intergenic
972912843 4:43839594-43839616 TAAGTGACTAAATCAAAAGCTGG - Intergenic
975103885 4:70546590-70546612 GGAATTACTAGGTCAAGATCGGG - Intergenic
977615306 4:99081974-99081996 GGAGTTACTAAGCTGAAGGCGGG - Exonic
980387854 4:132110488-132110510 GGTTTTACTGAGTGAAAAGCGGG + Intergenic
981845741 4:149166597-149166619 GGAGAGACAAAGTCCAAAGCTGG - Intergenic
982375760 4:154688945-154688967 GGAGTTGCTAAGTACACAGCTGG - Intronic
982470488 4:155783627-155783649 GTATTTAATAAGTCAAAACCTGG - Intronic
983089301 4:163485419-163485441 GGACTTCTTAACTCAAAAGCCGG - Intergenic
990162662 5:52959869-52959891 GGAGTTACTAAGGAAGAATCTGG + Intergenic
990262568 5:54040898-54040920 GGAGTTACAAAGTAAAAACAAGG - Intronic
990985111 5:61634269-61634291 GGTGTTACACAGTAAAAAGCGGG - Intergenic
993598827 5:89893861-89893883 AGAGTTACGCAGACAAAAGCTGG + Intergenic
994087030 5:95770350-95770372 GGAGTTAATGAGTCCAAGGCTGG - Intronic
994264334 5:97697062-97697084 GGAGCTTCTAAGCCAATAGCAGG + Intergenic
1000706360 5:164517871-164517893 GCAGTTACAAAATCAAAATCAGG + Intergenic
1002397150 5:178966900-178966922 GGCGTTGCTAAGTCAGAAGAGGG - Intergenic
1002589053 5:180275607-180275629 GGAGTTACTAGGTCAGGATCTGG - Intronic
1002950303 6:1803185-1803207 GCAGTAACTAACTGAAAAGCAGG - Intronic
1009603695 6:65837798-65837820 GGAGTTACTAAGCTGAAGGCGGG - Intergenic
1010065857 6:71681754-71681776 GGAGTTACTAAGACAGGAGTTGG - Intergenic
1010403010 6:75468666-75468688 GGAGTTACTAAGATATTAGCAGG + Intronic
1010631552 6:78204803-78204825 GGAGTTACTATGTCAAGGTCAGG - Intergenic
1012353232 6:98279331-98279353 GGAGATACTAATTTAAGAGCTGG - Intergenic
1013555500 6:111252864-111252886 GGAATTAATAAAACAAAAGCTGG + Intergenic
1014707224 6:124762353-124762375 GGAGTAATTAAGTCAAAATAAGG - Intronic
1015445355 6:133297567-133297589 GGTGTTAGTAAGGCAAAACCAGG - Intronic
1015742791 6:136475171-136475193 GGAATTAGTAGGTCAAAAGTAGG + Intronic
1018787911 6:167122470-167122492 GGAGCTCCTCAATCAAAAGCGGG - Intergenic
1023200006 7:37686711-37686733 GTAGTTGCTAAGTCCAAAGATGG + Intronic
1023873410 7:44274662-44274684 GGAGGTACTATGTGCAAAGCAGG + Intronic
1024186182 7:46950471-46950493 GTAGTAACAAAGTCAAAACCAGG + Intergenic
1027357145 7:77368651-77368673 AGACTTAGTAAGCCAAAAGCAGG - Intronic
1030769076 7:113451051-113451073 GGACTTGCTAAGTCAAGGGCAGG - Intergenic
1034335406 7:150320020-150320042 GGAGTTTCTTACTCAAAAGAGGG - Intronic
1035629043 8:1094342-1094364 GGAGTTAGAAAGTCACAAGGTGG + Intergenic
1046685114 8:117216237-117216259 GGATTTACCAAGTCAAAATTAGG - Intergenic
1050157594 9:2683936-2683958 GGAGTGACTAAGTCATTTGCTGG + Intergenic
1051939398 9:22486961-22486983 GGTGTTAAGAGGTCAAAAGCGGG + Intergenic
1056074359 9:83023460-83023482 GGAGTAAATAAGTCAAAAGCAGG - Intronic
1057406370 9:94774721-94774743 AGAATTACTGAGTCAAAAGTTGG + Intronic
1060738351 9:126080850-126080872 GGAGTGAGTAACTCAAAAGCAGG + Intergenic
1187119689 X:16392238-16392260 GGAGTTACTTTGGCAAAACCTGG + Intergenic
1188751553 X:33911361-33911383 GGAGTCACCGAGTCCAAAGCAGG + Intergenic
1192129739 X:68538075-68538097 GTAGTTTATAAGTCAAGAGCGGG - Intergenic
1192353257 X:70374788-70374810 GGAGTCACTGAGTAAAAAGAAGG - Intronic
1193416999 X:81237734-81237756 TGAGCTACTAAGACAATAGCTGG + Intronic
1193873148 X:86826586-86826608 TGAGTTACTAATTCGAAAGTAGG - Intronic
1195245949 X:102995384-102995406 GGAGTTACTAAATCATGAGAAGG + Intergenic
1195641454 X:107179743-107179765 GGAATTGCTAAGTCAAAAGGTGG + Intronic
1198065397 X:133091482-133091504 GGTGTTAAAAAGTCAAAATCAGG + Intronic
1199168212 X:144702761-144702783 GGAGTTATTTAGACAACAGCAGG - Intergenic