ID: 1117982871

View in Genome Browser
Species Human (GRCh38)
Location 14:61359047-61359069
Sequence CCTTCAGGACTGAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117982871_1117982881 23 Left 1117982871 14:61359047-61359069 CCTCCCAGCCTCAGTCCTGAAGG 0: 1
1: 0
2: 3
3: 27
4: 328
Right 1117982881 14:61359093-61359115 CTCATATTTTTGTGCCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117982871 Original CRISPR CCTTCAGGACTGAGGCTGGG AGG (reversed) Intronic
900157165 1:1207779-1207801 TCTTCAGCCCCGAGGCTGGGAGG + Intergenic
900836758 1:5010821-5010843 CCAACAGGAGTGAGGCTGGCAGG - Intergenic
901783242 1:11608443-11608465 CATCCAGGACTCAGGCTGGTGGG - Intergenic
902227999 1:15008842-15008864 CCTTGAGGACTGTGGCTGGCAGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903186061 1:21629653-21629675 CCTTCAGGTCTGGGGATGGATGG - Intronic
904211376 1:28888380-28888402 CCTCCAGGCCTGAAACTGGGTGG - Intronic
904397362 1:30230889-30230911 GCTTCAGGGCTGAGTCAGGGGGG - Intergenic
905224101 1:36467948-36467970 CATTCAGGATGGCGGCTGGGAGG + Exonic
905797851 1:40825571-40825593 CCTCCAGGTCTGGGGCTGGAGGG + Intronic
906064248 1:42968784-42968806 CATTTGGGGCTGAGGCTGGGAGG + Intergenic
906676380 1:47696702-47696724 CCTTCAGGACTGAGCCCCAGAGG + Intergenic
911357761 1:96843162-96843184 ACTTCAGCACTGAGGCTGTGGGG + Intergenic
912702204 1:111886850-111886872 CCTTCAGGAAGGAGGCTTAGTGG - Intronic
912891200 1:113533429-113533451 CCTTCAGGGTGGAGGGTGGGAGG + Intronic
913210665 1:116579729-116579751 CCCTGAGGACTAAAGCTGGGGGG - Exonic
914453478 1:147813961-147813983 AATTCAGGTCTGAGGCTGGTAGG + Intergenic
915782341 1:158566759-158566781 CCCTCAGGACTGACCCTGGTAGG - Intergenic
917463218 1:175250441-175250463 TCTTCAGGACTGGGGCAGTGAGG + Intergenic
917488851 1:175480087-175480109 CCGTCAGTTCTGAGTCTGGGAGG - Intronic
918687854 1:187442110-187442132 TATACAGGACTGAGGGTGGGTGG - Intergenic
919809279 1:201398913-201398935 CTCTCAGGAATGAGGCTTGGAGG + Intronic
919938048 1:202268026-202268048 TCTCCAGGAGAGAGGCTGGGAGG + Intronic
920300503 1:204985888-204985910 CCTTCGGGACAGAGGCAGGCTGG - Intronic
920822985 1:209398686-209398708 CCTGCAGGGCTGGGGCAGGGCGG - Intergenic
920854924 1:209654384-209654406 CCCTCAGGAGTGAGGCTGGCTGG - Intergenic
920870879 1:209793715-209793737 CCTTGAGGACGGAGGGTGGGAGG - Intronic
922519739 1:226238809-226238831 TCTTCAACACTGATGCTGGGAGG + Intronic
923127562 1:231045786-231045808 CATTCAGGAATGAGGGAGGGAGG + Intergenic
923974307 1:239243211-239243233 TTTTCAGGACTCAAGCTGGGAGG - Intergenic
924368976 1:243327036-243327058 CCTTCAGGAATGAGTCTGCTGGG + Intronic
1062964451 10:1596547-1596569 CCATCAGGACAGAGGCTTGCAGG + Intronic
1063123679 10:3122599-3122621 GCTTCAGGACAGTGGCCGGGGGG - Intronic
1063957537 10:11280779-11280801 CAACCAGGACTGAGGCTGGAGGG - Intronic
1064104151 10:12487165-12487187 CCTTCAGGGTGGAGGATGGGAGG - Intronic
1065592310 10:27276916-27276938 CCTTAAGGATGGAGGGTGGGAGG + Intergenic
1066224330 10:33367598-33367620 ATATCAGGACTGAGGTTGGGAGG + Intergenic
1068451985 10:57202558-57202580 CCTTCTGCACTGAGGCTCTGAGG - Intergenic
1069097387 10:64275935-64275957 GCTGCAGAACTGAGACTGGGAGG + Intergenic
1069749162 10:70734663-70734685 CCTTGAGGCCTGAGAATGGGAGG + Intronic
1070775677 10:79108450-79108472 CTTTCAGCACTGGGGATGGGAGG + Intronic
1070832414 10:79426264-79426286 GCTTCAGGACCTAGGCAGGGTGG + Intronic
1072537871 10:96377012-96377034 CCTTCCTGACTGTGGCTCGGGGG + Intronic
1072703750 10:97664878-97664900 TCTTCAGGACACAGACTGGGTGG + Exonic
1073492211 10:103860150-103860172 CCTTCAGGAACGAGTGTGGGTGG + Intergenic
1073609788 10:104931708-104931730 TGTTCAGGACTGAGACTAGGAGG + Intronic
1074109314 10:110411191-110411213 TCTTCAGGCCTGCGGCTGGTGGG + Intergenic
1074815347 10:117137921-117137943 CCTTGAGGAAGGCGGCTGGGAGG + Exonic
1075336824 10:121614796-121614818 CAGTCAGGAAGGAGGCTGGGAGG - Intergenic
1075532120 10:123238460-123238482 CCTTCAGGACTCAGCTTAGGGGG + Intergenic
1075959047 10:126551165-126551187 CCTAGAGAACTGAGGCTTGGAGG - Intronic
1078102242 11:8336791-8336813 CCTCCTGGGCTAAGGCTGGGCGG + Intergenic
1078175062 11:8964179-8964201 CCGTCAGGAGCGAGGCTGGGCGG + Intronic
1081802763 11:45870992-45871014 CATTCAGGACTGAGGCCAGAAGG + Intronic
1083726638 11:64631857-64631879 CGTTCAGGAGTGCTGCTGGGAGG - Intronic
1084312767 11:68326424-68326446 CCTTCAGCAGTGAAGCTGAGTGG - Intronic
1084702779 11:70798401-70798423 CCTGCAGGATCGAGGGTGGGCGG + Intronic
1085326545 11:75610831-75610853 ACTCCAGGACTCTGGCTGGGGGG + Intronic
1085473314 11:76771937-76771959 CCCTCAGGGCTGAGACTGGAGGG - Intergenic
1087926267 11:103922428-103922450 CCTTCAGGATGGAGGGTGAGGGG - Intronic
1089043756 11:115480811-115480833 CCTGCAGGGCTGAGGCCTGGAGG - Intronic
1089059123 11:115611813-115611835 CCTCCAGGCCTCAGGTTGGGTGG - Intergenic
1089135454 11:116245569-116245591 CCTATAGGACTGAGGCTCAGTGG + Intergenic
1089630709 11:119782540-119782562 CCTTCAGGTCTTAGGCGGGGAGG + Intergenic
1090443725 11:126745890-126745912 CTTTCAGGAGTAAGGCAGGGAGG - Intronic
1090558230 11:127899144-127899166 CCCTCAGGACTTAGGGTGGCTGG + Intergenic
1090616592 11:128521496-128521518 CCCATAGAACTGAGGCTGGGTGG - Intronic
1091845822 12:3655724-3655746 CCTCCAGGAGGCAGGCTGGGTGG - Intronic
1096610756 12:52799929-52799951 CCTTGAGACCTGAGGCTGAGAGG - Intergenic
1096617852 12:52844428-52844450 CCTGAAGGTCTGGGGCTGGGTGG - Intronic
1102876962 12:116456531-116456553 CCACCAGGACAGAGCCTGGGAGG - Intergenic
1102950643 12:117028511-117028533 CCTGCAGGGCTGGAGCTGGGAGG - Exonic
1104793244 12:131497428-131497450 CCTTCAAGGCTGAAGCAGGGGGG - Intergenic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1104861702 12:131927581-131927603 GCTCCAGGACTGAGGCGGGGGGG - Intergenic
1105325952 13:19370736-19370758 CCTTCAGTACTGAGACTGCTAGG - Intergenic
1105867555 13:24474358-24474380 CCTTCAGGGCTGAGACTGCTAGG + Intronic
1107462837 13:40620699-40620721 GTTTCAGGTATGAGGCTGGGTGG - Intronic
1108298750 13:49053033-49053055 CCTTCAGGACTGCGGCCGAGTGG - Intronic
1109566920 13:64130584-64130606 CCTGCAGCACTGAGGCTTGCTGG - Intergenic
1113045542 13:106151042-106151064 ACTGCAGGACTGAAGCAGGGTGG - Intergenic
1113691876 13:112316822-112316844 CCTTCAAGATGGAGGCTGGTAGG + Intergenic
1116521871 14:45858655-45858677 CCTTGAGGTTTGAGGGTGGGAGG - Intergenic
1117920194 14:60721310-60721332 CCATTTGGTCTGAGGCTGGGAGG + Intronic
1117982871 14:61359047-61359069 CCTTCAGGACTGAGGCTGGGAGG - Intronic
1118789841 14:69080241-69080263 CCTCCTGGACTCAGGCTGGTTGG + Intronic
1121446773 14:93983748-93983770 TCTGCAGGACCGAGGCTGTGTGG - Intergenic
1122018028 14:98813377-98813399 CCTTCAGTAATGAGGATTGGAGG + Intergenic
1122151613 14:99728937-99728959 GCTGCAGTACTGAGGCTTGGTGG - Intergenic
1122862408 14:104588507-104588529 CCTGGAGGACTGGGGCTGGTGGG - Intronic
1122903158 14:104790261-104790283 CCTGCAGGAGCAAGGCTGGGGGG + Intronic
1123043844 14:105501888-105501910 CCTTGAGGGATGAGGCTGGTTGG + Intergenic
1123907281 15:24933415-24933437 CCTAGAGGAGAGAGGCTGGGAGG + Intronic
1125814979 15:42576128-42576150 CCATGAGGACTGAGGCTGAATGG + Intronic
1125843159 15:42824711-42824733 ACTTCAGGATGGAGGGTGGGAGG + Intronic
1126114794 15:45198934-45198956 CATCCAGGAATGGGGCTGGGCGG + Exonic
1126195947 15:45932072-45932094 CCTTGAGGATGGAGGATGGGAGG - Intergenic
1126425567 15:48523788-48523810 CCTTCAGGACTCAAGCTAAGGGG + Intronic
1127801184 15:62478635-62478657 CCTCGAGGGCTCAGGCTGGGAGG + Intronic
1128303802 15:66584686-66584708 ACATCAGGATTGATGCTGGGTGG - Intronic
1129159200 15:73737808-73737830 CCCTCCGGACAGACGCTGGGGGG + Exonic
1130245885 15:82248299-82248321 CTTTCCAGAATGAGGCTGGGAGG - Intronic
1130411440 15:83652217-83652239 ACTTCAGCACTGTGCCTGGGGGG - Intergenic
1130454811 15:84095077-84095099 CTTTCCAGAATGAGGCTGGGAGG + Intergenic
1132288645 15:100684145-100684167 CCTTGAGGGTGGAGGCTGGGAGG - Intergenic
1132573081 16:652472-652494 GCCTCAGGACTGGGTCTGGGAGG - Exonic
1135958695 16:26977994-26978016 CCTGTAGGCCTGAGACTGGGAGG - Intergenic
1136276994 16:29184697-29184719 CACTCAGGACGGGGGCTGGGAGG + Intergenic
1138436014 16:57000459-57000481 GCCTCAGGCCTGAGCCTGGGTGG - Intronic
1139652447 16:68369316-68369338 CTTTCAGGACAGAACCTGGGAGG + Intronic
1139776946 16:69322411-69322433 CCTTCAGAACTCGGGCTGGGTGG - Intronic
1139851195 16:69952312-69952334 CCTCCTGAACTGAGGGTGGGGGG - Intronic
1139880174 16:70175224-70175246 CCTCCTGAACTGAGGGTGGGGGG - Intronic
1140372335 16:74420293-74420315 CCTCCTGAACTGAGGGTGGGGGG + Intronic
1140433041 16:74921241-74921263 ACTTGAGGACGGAGGGTGGGAGG - Intronic
1141624391 16:85253663-85253685 CTTCCAGGAAGGAGGCTGGGCGG - Intergenic
1142247954 16:88978408-88978430 CCCCCAGGACTGAGGCTGGAGGG + Intergenic
1142582322 17:949758-949780 CTTTCCAGACTGAGGCAGGGAGG - Intronic
1143967614 17:10767997-10768019 TCTTCAGGACTGAATCTGGATGG + Intergenic
1146296737 17:31655982-31656004 CCATCAGGCCAGAGGCGGGGTGG - Intergenic
1147157888 17:38553580-38553602 CCCTCAGGAAAGAGGCTGTGTGG - Intronic
1147242067 17:39097042-39097064 CCCCCAGGAGTGAGGCTGTGAGG + Intronic
1147388844 17:40097199-40097221 CCGTCATCACTCAGGCTGGGTGG + Exonic
1147422705 17:40330597-40330619 CCCTCAGGACTGTGGGTGAGAGG + Intronic
1148554999 17:48573154-48573176 CCTCCAGGAAGAAGGCTGGGGGG + Intronic
1149344751 17:55723376-55723398 CATTTAGGAATGAGGGTGGGAGG + Intronic
1149550365 17:57535139-57535161 CCATCAGGGCTGAGGTTGTGGGG - Intronic
1149561524 17:57611177-57611199 ACTCAAGGACTGAGACTGGGAGG + Intronic
1150278362 17:63914130-63914152 CCTTTAGGAATGAGGGTGGCAGG + Intronic
1151934933 17:77255706-77255728 CTTTCAGGGCAGAGGCAGGGTGG + Intergenic
1152016446 17:77754008-77754030 GCTTCAGGGCTGGGGGTGGGAGG - Intergenic
1152257520 17:79248778-79248800 CTTTGGGGACTGAGGCTGGCAGG + Intronic
1152361609 17:79835570-79835592 CCTCCAGGCCTGGGGATGGGGGG - Intronic
1152494893 17:80664069-80664091 CCTCCAGGGCTGCGTCTGGGAGG + Intronic
1152806118 17:82357197-82357219 TCCTGAGAACTGAGGCTGGGAGG + Intergenic
1153973950 18:10250290-10250312 ACTTGAGGATGGAGGCTGGGTGG - Intergenic
1155115995 18:22767584-22767606 GCAGCAGGACTGAGGATGGGAGG - Intergenic
1157304843 18:46509389-46509411 CCTTCAGGACAGCAGCTGGGAGG - Intronic
1157797030 18:50584085-50584107 CCTTGAGGACTGATGCTTGCTGG + Intronic
1159053164 18:63440547-63440569 CCTTGGGGTCTGAGGTTGGGTGG + Intergenic
1160029945 18:75249682-75249704 ACTGCAGGAGTGAGGCAGGGAGG - Intronic
1160560821 18:79754867-79754889 GCTGCGGGACTGATGCTGGGAGG - Exonic
1160773940 19:846269-846291 CCTGCAGGACCTGGGCTGGGGGG - Exonic
1160902537 19:1435818-1435840 GCTTCAGGGCAGAGGCTGAGTGG + Intergenic
1160907391 19:1457869-1457891 CCTTCAGGCCTGGGGCGGGCGGG + Intronic
1161388931 19:4011302-4011324 GCTTCAGGGCTAAGGGTGGGTGG + Intronic
1161585609 19:5103858-5103880 CCTTAAGGACCAAGGCAGGGTGG - Intronic
1161709240 19:5838575-5838597 CAGACAGGACTGAGGCTGAGGGG + Intronic
1162152864 19:8657923-8657945 ACTTCAAGGCTGAGGCTGAGGGG + Intergenic
1162325455 19:9996465-9996487 CCTGCTGGAATGAGACTGGGGGG + Exonic
1162412581 19:10515333-10515355 GCCTCAGGCCTGAGCCTGGGGGG - Intronic
1162782028 19:13011493-13011515 ACTTCAGGAGTGAGGGTGGGTGG + Intronic
1162907276 19:13831365-13831387 GCTCCAGGAGGGAGGCTGGGAGG + Exonic
1163290517 19:16376615-16376637 GCTTCAGGACTGAGAGTGGAGGG - Intronic
1163389527 19:17021944-17021966 CCTTCAGGGCTGGGGCAGTGTGG - Intronic
1163397167 19:17070363-17070385 CCTTCAGGGCTGAGACAGGCTGG + Intronic
1165350040 19:35270113-35270135 CCTTCAGGCCTCAGGCTGCATGG + Intronic
1166382427 19:42362014-42362036 CCTGCAGGACAGTGTCTGGGAGG + Intronic
1167299810 19:48671987-48672009 CCTTCAGAACTCAGGGTGTGGGG + Intronic
1167503000 19:49857822-49857844 CCTCACGGACTGTGGCTGGGAGG + Intronic
1167857135 19:52251235-52251257 ACTTGAGGATGGAGGCTGGGAGG - Intergenic
1168350608 19:55673851-55673873 CCTTCAGTGCTGGGGTTGGGTGG + Intronic
1168404184 19:56102404-56102426 TCCTCAGGTCTGAGGCAGGGAGG + Intronic
926098503 2:10098240-10098262 CCTGCAAGAGTGAGGCGGGGCGG + Intergenic
926167740 2:10532023-10532045 CCTTCAGGACTGAGCCCAGGCGG + Intergenic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
927698024 2:25251114-25251136 CCATCAGGACTGGGGCAGTGGGG + Intronic
927719463 2:25373437-25373459 CCTTCAGGCCGGAAGGTGGGGGG + Intergenic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
928654739 2:33439006-33439028 CCATCTGGCCTGACGCTGGGTGG + Intronic
929053047 2:37854102-37854124 GCTCCAGGACTGAGCCTGGGTGG + Intergenic
930002729 2:46871880-46871902 GCTCCAGGACTCATGCTGGGAGG - Intergenic
930502024 2:52233489-52233511 ACTTGAGGGCTGAGGGTGGGAGG + Intergenic
931429361 2:62196592-62196614 CCCTCTGGGCTGAGGTTGGGTGG - Intronic
931758663 2:65396818-65396840 CCTTCAGGACTGAAGCACTGAGG - Intronic
933182225 2:79240366-79240388 CCTTGAGGATAGAGGGTGGGAGG - Intronic
933707939 2:85305375-85305397 ACTGCAGGGCTCAGGCTGGGGGG - Exonic
934525578 2:95049616-95049638 CCTCCAGGACTGAGGCGCTGAGG - Exonic
935393939 2:102585892-102585914 CCTTCAGGCCTGGGGGTGGCAGG + Intergenic
936288504 2:111200021-111200043 TCTGCAGGACTCAGGATGGGAGG + Intergenic
936349188 2:111700035-111700057 CCCTCAGGACAGTGGCTGGGCGG + Intergenic
940847365 2:158656506-158656528 CCTTCAGGACACAGGACGGGCGG - Intronic
940863649 2:158795439-158795461 CCTGCAGGACTGAGGGCAGGTGG - Intronic
942450620 2:176106221-176106243 CCTTCAGCACTGAAGCCAGGAGG - Intronic
946090013 2:217213507-217213529 CCTTGAGGACGGAGGGTGGAAGG + Intergenic
946464829 2:219902729-219902751 CCTGCAGGCCTGAGGGTGTGAGG + Intergenic
947454293 2:230239256-230239278 CATTCAGGACTGAGAGTGGTGGG - Intronic
947769974 2:232662795-232662817 CCTGCAGGTATGACGCTGGGCGG + Exonic
948370734 2:237487606-237487628 CCTGGGGGACTAAGGCTGGGTGG - Intronic
948459824 2:238123734-238123756 CCTCCGGGGCTGGGGCTGGGCGG + Intronic
948866121 2:240775724-240775746 CTTTCTGGGCTGAGGCTGGGAGG - Intronic
1169182324 20:3580537-3580559 CCCTTAGGACAGAGGCTGGCTGG + Intronic
1170826748 20:19802715-19802737 CCTTCAGGACTCAGTCAAGGTGG - Intergenic
1172781440 20:37439050-37439072 TCTTCAGGACACAGCCTGGGTGG - Intergenic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1173896579 20:46555529-46555551 CCTTGAGGCCTTGGGCTGGGAGG + Intergenic
1174040785 20:47697906-47697928 CCGCCTGCACTGAGGCTGGGAGG + Intronic
1174173769 20:48632469-48632491 GCTTCAGGCCTGGGGCAGGGAGG - Intronic
1174798229 20:53540321-53540343 ACCAGAGGACTGAGGCTGGGAGG - Intergenic
1175127743 20:56764944-56764966 ACTTCATGACTGGGGCGGGGTGG + Intergenic
1175332928 20:58177288-58177310 CCTGCAGGACACAGGCTGGTTGG - Intergenic
1178358952 21:31932338-31932360 CCTTCAGGACAGAGGGTGCGAGG - Intronic
1178907164 21:36646350-36646372 CCCTGAGGACAGAGACTGGGTGG - Intergenic
1179303576 21:40134888-40134910 ACTTCAGGATTGAAGCTGAGAGG - Intronic
1180058543 21:45373235-45373257 GCTTCAGAAGTGAGGCTGTGTGG - Intergenic
1180127594 21:45802753-45802775 CCTCCAGGGCTGGTGCTGGGAGG + Intronic
1180720944 22:17907974-17907996 TCTGCTGGACAGAGGCTGGGAGG + Intronic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1180876339 22:19176906-19176928 GCTTCAGGACAGTGGCTGTGAGG + Exonic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1181415735 22:22757547-22757569 CCTCCAGGCCTGAGGCTGTCTGG + Intronic
1182067919 22:27443501-27443523 CCTTGAGGAGGGAGGGTGGGAGG - Intergenic
1182469417 22:30538937-30538959 CCTGCAGGACCGAGGGTGGTTGG - Intronic
1183253362 22:36745486-36745508 ACTTTAGGGCTGAGGCAGGGAGG - Intergenic
1183413701 22:37670956-37670978 GGTTCAGGCCTGAGTCTGGGAGG + Intergenic
1183987987 22:41579782-41579804 CCTTCAGATCTCAGGCTAGGGGG - Intronic
1184098224 22:42328149-42328171 CCTGCATGGCTGAGCCTGGGAGG - Intronic
1184248150 22:43245985-43246007 CCTGCAGGACTGTGGCATGGGGG + Intronic
1184339822 22:43880145-43880167 TCTGCAGGAATGAGGCTGTGGGG + Exonic
1184670099 22:46007822-46007844 ACTTCAGGCCGGAGGCTTGGCGG - Intergenic
1184694489 22:46131881-46131903 CCTTCAGGAGTGTGGGTCGGGGG + Intergenic
1184775222 22:46619785-46619807 CCTAGAGGACTGAGACTTGGAGG + Intronic
1184855990 22:47147080-47147102 CCTTCTGGACTCAGGCTGGGCGG - Intronic
1185415764 22:50709320-50709342 CATTCAGGAGTGAGGCAGAGAGG + Intergenic
949189582 3:1235894-1235916 CCTTTAGGACTCACGCTGTGTGG + Intronic
952822834 3:37499672-37499694 CCCTCAGGGCTGAGGCTGAAGGG - Intronic
953093521 3:39752896-39752918 CACTCAGAACTGAGGCTGAGAGG + Intergenic
954121925 3:48504539-48504561 CCGCCGGGACTGCGGCTGGGAGG - Intronic
954416838 3:50397429-50397451 CCATCAGGCCTGAGGATGAGAGG + Intronic
954930520 3:54277098-54277120 CCTTCAGGCCTGGGCCAGGGAGG + Intronic
954957332 3:54533158-54533180 CTTTCAGGAATGAGGCTAGGTGG - Intronic
955731985 3:61996890-61996912 ACTTGGGGACTGAGGCTGTGGGG - Intronic
955996546 3:64685710-64685732 CCCTAGGGACTGAGGCAGGGCGG - Intronic
961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG + Intergenic
961407615 3:126692833-126692855 TCTTCAGGTCTGAGGGTGGTGGG + Intergenic
963336583 3:143981511-143981533 CCTTTAGGTCTCAGCCTGGGTGG + Intronic
964299322 3:155270903-155270925 CCTTTAGGACTGTGGCTGTGTGG + Intergenic
967186458 3:186948692-186948714 CCTCCGGAACTGAGGCTGGCTGG - Intronic
968666623 4:1825911-1825933 CCATCAGGACAGAGGGTTGGAGG - Intronic
968811347 4:2800907-2800929 CCTTGAGCCCTGAGGCTGAGCGG + Intronic
968933967 4:3600321-3600343 CCTGCGGGCATGAGGCTGGGTGG - Intergenic
969126318 4:4951008-4951030 CCCTCAGCACTGTGTCTGGGAGG + Intergenic
970280417 4:14449016-14449038 CCTTCTGGTCTGAGAGTGGGAGG - Intergenic
972382920 4:38535998-38536020 TCTTCAAGCCTGAGGCGGGGTGG - Intergenic
973613257 4:52657350-52657372 CCCGCAGCACTGAGGGTGGGTGG + Intronic
973813553 4:54597113-54597135 TCACCAGGACTGAAGCTGGGTGG + Intergenic
974429687 4:61779598-61779620 ACTGCAGCACCGAGGCTGGGTGG - Intronic
975838488 4:78449659-78449681 CCTTCAGGACAGAGGATGTTAGG - Intronic
978061408 4:104344776-104344798 CATGCAGGAGGGAGGCTGGGAGG + Intergenic
981542669 4:145861744-145861766 GCTTCAGGACTAGGGCAGGGAGG - Intronic
983742529 4:171153148-171153170 CCATCAGAAGTGAGGGTGGGCGG - Intergenic
985676541 5:1234419-1234441 GCTTCTGGAGTGTGGCTGGGAGG - Intronic
986335917 5:6755186-6755208 CCTTCAGTGCTGAGGCAGGTCGG + Exonic
986431159 5:7682568-7682590 TCTTCAAGACTGAATCTGGGAGG + Intronic
988485655 5:31666221-31666243 GCTCCAAGACTGAGGCTGGCTGG - Intronic
991745222 5:69732607-69732629 CATTCAGGACATAGGCAGGGTGG + Intergenic
991796790 5:70312336-70312358 CATTCAGGACATAGGCAGGGTGG + Intergenic
991802102 5:70379351-70379373 CATTCAGGACATAGGCAGGGTGG - Intergenic
991831803 5:70697744-70697766 CATTCAGGACATAGGCAGGGTGG - Intergenic
992493238 5:77266413-77266435 GCTTCAGCACTATGGCTGGGGGG - Intronic
992921373 5:81525328-81525350 CCTTGAGGATGGAGGGTGGGAGG - Intronic
993375364 5:87144010-87144032 CCATCAGGAGTGGGGCTAGGGGG - Intergenic
994683317 5:102917189-102917211 TCTTCAGGGCTGAGCCTGTGAGG - Intronic
994721677 5:103387519-103387541 ACTTGAGGATGGAGGCTGGGAGG - Intergenic
994796539 5:104307841-104307863 CCTTCAGGGCAGAGGCTTGGCGG - Intergenic
994906105 5:105842382-105842404 CCTTCAGGATTGAGGGTCTGAGG - Intergenic
994940778 5:106321334-106321356 CCTTCAGGACTAGGCCTGTGTGG - Intergenic
995327084 5:110902918-110902940 CCTTCAGGACAAAGGTTGGCAGG - Intergenic
998160301 5:139809337-139809359 CAGACAGGACTGGGGCTGGGGGG - Intronic
998184640 5:139968858-139968880 CCTCCTGGGCTGAGGCTGGGAGG - Intronic
998374039 5:141679924-141679946 CCCTAGGGACTGATGCTGGGAGG - Intronic
998852576 5:146364935-146364957 CCTTCAGGATTGAGGCTTGGGGG - Intergenic
999142413 5:149371302-149371324 CATCCAGGACTGAGGATGTGTGG - Intronic
999451676 5:151683074-151683096 GGTTCAGGATTGAGGTTGGGAGG + Intronic
999889076 5:155957250-155957272 CCTTCAGTGCTGAGGCTGCTGGG + Intronic
1001503480 5:172257135-172257157 CCTTGAGGGCAGAGGATGGGAGG - Intronic
1002006555 5:176238826-176238848 GCTTCAGCGCTGAGCCTGGGAGG - Intronic
1002181047 5:177431339-177431361 CCCTCAGGGCTGGGCCTGGGAGG - Intronic
1002219823 5:177671810-177671832 GCTTCAGCGCTGAGCCTGGGAGG + Intergenic
1002589861 5:180283035-180283057 CCCTCAGGACTGAGGCCAGACGG - Intronic
1002866311 6:1125278-1125300 CCTTCTGGACTGAGGGTAGGTGG - Intergenic
1003441468 6:6146460-6146482 ACTTCAGGGCAAAGGCTGGGAGG - Intronic
1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG + Intergenic
1007217664 6:40252977-40252999 CATTGAGGACTAGGGCTGGGAGG + Intergenic
1007249901 6:40488454-40488476 CCTGCAGGAGGGAGGCTTGGAGG - Intronic
1007257452 6:40538776-40538798 GGTCCAGGACTGGGGCTGGGGGG + Intronic
1007825189 6:44594855-44594877 CTGTGAGGACTGAAGCTGGGAGG + Intergenic
1011772844 6:90694063-90694085 CACTCAGTACTGAGGCTGGAGGG - Intergenic
1015131640 6:129817842-129817864 TCCACAGGACTGAGGCAGGGAGG + Intergenic
1016330145 6:142946102-142946124 CCTTAAGGACAGAGGGAGGGCGG + Intergenic
1016918301 6:149265596-149265618 CTTTCAGTACAGATGCTGGGTGG - Intronic
1017622653 6:156315143-156315165 CCCCTAGGACTGAGGCTGGAAGG + Intergenic
1017719045 6:157232382-157232404 TCTGCAGGACTGGGGCTGAGGGG - Intergenic
1018373399 6:163188507-163188529 CCTTCAGGCCTGAGGATCAGTGG - Intronic
1018610291 6:165641915-165641937 CCTGCAGGACAGAGGCTGCGGGG - Intronic
1018667873 6:166156213-166156235 CCTTAAGCTCTGAGGTTGGGGGG - Intergenic
1018824251 6:167397415-167397437 CCAACAGGCCTGAGGCTGGCTGG + Intergenic
1019578209 7:1747692-1747714 CCTGCTGGACTCAGGGTGGGTGG + Exonic
1019647603 7:2139402-2139424 CCTTCACTGCTGAGGGTGGGGGG - Intronic
1020120775 7:5502031-5502053 CCTGCGGGACAGAGGCAGGGTGG + Exonic
1020756653 7:12211459-12211481 CCTTCCGGAGCGAGGCTGAGCGG + Intronic
1022508656 7:30921965-30921987 CCTTCATGCCTGGGCCTGGGAGG + Intronic
1023004516 7:35848906-35848928 GCTACACGTCTGAGGCTGGGAGG - Intronic
1024064119 7:45718732-45718754 CCAGCTGGACTGAGCCTGGGGGG + Exonic
1024903002 7:54343688-54343710 CCTCCAGGGCTGGGGCTGGACGG - Intergenic
1027477726 7:78654390-78654412 CATTCAAGACTCAGGTTGGGAGG - Intronic
1029460613 7:100692102-100692124 CCAGCAGGCCTGGGGCTGGGCGG - Intergenic
1029640112 7:101815524-101815546 CCTTCAAGACTCCGGTTGGGGGG - Intergenic
1032203414 7:129840292-129840314 CTTGGAAGACTGAGGCTGGGAGG - Intronic
1032391655 7:131558784-131558806 CTTTCTGGAATGAGGCTGGCTGG + Intergenic
1033785051 7:144719889-144719911 CCTCCAAGACTGAAGCTGGAGGG - Intronic
1035524694 8:303512-303534 GGTTCAGGACACAGGCTGGGAGG - Intergenic
1035535297 8:386336-386358 TCCTCAGGCCAGAGGCTGGGCGG - Intergenic
1035663621 8:1364534-1364556 CCTGGAGGACTGGGGCTGGCGGG + Intergenic
1039891145 8:41686340-41686362 CCTCCAGCACACAGGCTGGGTGG + Intronic
1040858054 8:51970452-51970474 CCTTCAGGCCTGAGGGTAGGTGG + Intergenic
1042080052 8:65041786-65041808 CCTACAGCAGTAAGGCTGGGAGG - Intergenic
1043391284 8:79794736-79794758 CTTTCTGTACTGAGGCTGGCTGG - Intergenic
1044729736 8:95220277-95220299 CCTTGAGGATGGAGGCTGGATGG - Intergenic
1045957176 8:107922200-107922222 GCTTTAGGGCTGAGGCTGTGGGG - Intronic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1047493266 8:125391055-125391077 CCTGGAGGAGTGAGGGTGGGAGG + Intergenic
1048197784 8:132346752-132346774 CCTGCAGGACAGAGTCTGGGAGG + Intronic
1048514240 8:135091363-135091385 CCTCCAGCAAGGAGGCTGGGAGG - Intergenic
1048754578 8:137723440-137723462 ACTTGAGGACAGAGGGTGGGAGG - Intergenic
1048971425 8:139647085-139647107 TCTGCAGGTCTGAGGCTGGAAGG + Intronic
1049166166 8:141127888-141127910 GCTTCAGGACTGAGGGTCAGAGG - Intronic
1049191180 8:141288637-141288659 CCTGCAGGACTGAGGCAGCCAGG + Intronic
1052429278 9:28346197-28346219 ACTTGAAGACTGAGGGTGGGAGG - Intronic
1052804759 9:33002875-33002897 CCTTCAAGACAGAAGGTGGGAGG + Intronic
1053098670 9:35351147-35351169 CCTTTAAGACTGGGGTTGGGAGG + Intronic
1053111576 9:35465025-35465047 CCTTCAGGATTCAGGCTGTCAGG + Intergenic
1053470128 9:38340321-38340343 TCTTCAGGATAAAGGCTGGGCGG + Intergenic
1058958107 9:109968096-109968118 GATTTAGGACTGAGGCTGTGTGG + Intronic
1060420116 9:123462440-123462462 CATTTAGGACTGAGGCTGCAGGG - Intronic
1061242923 9:129384645-129384667 CATTGAGGACTGCGGGTGGGTGG - Intergenic
1061767431 9:132890308-132890330 CCTTTGAGACTAAGGCTGGGAGG - Intergenic
1062217411 9:135396769-135396791 TCTGCAGGACTGAGGCTGGGAGG + Intergenic
1062282719 9:135759187-135759209 CGCCCAGGCCTGAGGCTGGGAGG - Intronic
1062612386 9:137380754-137380776 GCTTCAGTAGTGGGGCTGGGGGG + Intronic
1186474827 X:9849216-9849238 GCCTCAGCACAGAGGCTGGGAGG + Intronic
1187044037 X:15627986-15628008 CCTTCATGACAGAGGATGAGAGG - Exonic
1187125131 X:16447717-16447739 CATTCAAGAATGAGGCAGGGAGG + Intergenic
1187367762 X:18678325-18678347 TCTGGAGGACTGAGGCAGGGAGG + Intronic
1187876132 X:23805611-23805633 CGTTTAGGACTCAGGCAGGGAGG - Intergenic
1188982637 X:36740639-36740661 ACTTCAGGATGGAGGGTGGGAGG - Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189996147 X:46640472-46640494 TCTTCAGGCCTAAGGCTTGGTGG + Intronic
1190628844 X:52365637-52365659 TCCACAGGACTGTGGCTGGGTGG - Intergenic
1191637436 X:63393386-63393408 CCTCCAGGAGGGAGGTTGGGGGG + Intergenic
1193289690 X:79757171-79757193 ACTTCAGGATGGAGGGTGGGAGG - Intergenic
1195049055 X:101080215-101080237 CTTTTAGGGCTGAGGCAGGGAGG + Intronic
1195757206 X:108211172-108211194 CCATCAGCCCTGAGGCTGGCTGG - Intronic
1195816311 X:108893407-108893429 ACATCAGGACTGAGGCTATGGGG - Intergenic
1197984446 X:132252929-132252951 ACTTGAGGACGGAGGGTGGGAGG + Intergenic
1199257751 X:145735985-145736007 ACTTGAGGACAGAGGGTGGGAGG + Intergenic
1199488600 X:148374138-148374160 CTTTCAGGACTGAGCCAGGAAGG + Intergenic
1199552862 X:149077152-149077174 CCATCAGGAATGGGGGTGGGGGG - Intergenic
1201945426 Y:19505032-19505054 CCTTCAGGCCTGGGGCTGGTGGG + Intergenic