ID: 1117990584

View in Genome Browser
Species Human (GRCh38)
Location 14:61429118-61429140
Sequence CTGTTGGTCTGGAGAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117990580_1117990584 20 Left 1117990580 14:61429075-61429097 CCTCTGAATTGTTTTAGGGACTC 0: 1
1: 0
2: 2
3: 11
4: 133
Right 1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 175
1117990581_1117990584 -2 Left 1117990581 14:61429097-61429119 CCTAGCATTTTGCATGAGTTTCT 0: 1
1: 0
2: 2
3: 18
4: 283
Right 1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117990584 Original CRISPR CTGTTGGTCTGGAGAATAGA AGG Intronic
900114703 1:1023522-1023544 CTCATGGTCTGGGGAAAAGATGG + Intronic
905933460 1:41806149-41806171 GTGTTTGTCTGGAGAGCAGAGGG - Intronic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
909742401 1:79046217-79046239 CTGTTGGTCTGTGAAATATATGG - Intergenic
910248513 1:85168435-85168457 CTGTTGTTCCTTAGAATAGAAGG - Intronic
913263913 1:117025931-117025953 CTCATGGTCAGGAGAATACATGG + Intronic
919775492 1:201191604-201191626 CTGTTGGATTGGAGACTAGAGGG - Intronic
921059255 1:211568960-211568982 CTGTTTGTCTGTAAAATAAAGGG + Intergenic
924061113 1:240175401-240175423 CTGTTGCTATGGAAAATATATGG - Intronic
1063815615 10:9768169-9768191 GTGATGGGCTGGAGAATAAATGG - Intergenic
1064910815 10:20399925-20399947 CTGTTAGTCTGGGAAACAGATGG - Intergenic
1068275903 10:54796095-54796117 CTGTTGCTATAGAGAATTGATGG - Intronic
1071786439 10:88905565-88905587 CTTTAGGTCTGGAGTAGAGATGG + Exonic
1072012510 10:91315180-91315202 CTGTAGGCCTGCAGAAGAGATGG + Intergenic
1072659703 10:97356259-97356281 TTGTTGGTCTGGAGCAGAGAAGG - Intergenic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1073948832 10:108784011-108784033 CAGTTGGTCTGGAGAGCACATGG + Intergenic
1073948843 10:108784095-108784117 CCATTGGTCTGGAGAGTACATGG + Intergenic
1075306839 10:121375541-121375563 CTTTTGGTCTGGAGAGGAGATGG - Intergenic
1077602298 11:3582020-3582042 CTGTGGGGCTGGAGCATGGAGGG + Intergenic
1084477356 11:69396504-69396526 CAGTTGGCCTGGAAAACAGAAGG - Intergenic
1084814553 11:71638643-71638665 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
1085721215 11:78913932-78913954 CTGTTAGCCTGGAGAGGAGAAGG + Intronic
1087811566 11:102613934-102613956 GTGTTGGCCTGGAGAAGACAAGG + Intronic
1087920574 11:103862250-103862272 CTGCTGGTCTGCAGAATCCAAGG - Intergenic
1091772981 12:3165305-3165327 CTGTTGGTGGGGAAAATAGAGGG + Intronic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1093498126 12:19780280-19780302 CTTCTGGTCTGGAGAGTACACGG - Intergenic
1093930454 12:24950286-24950308 CTGTTGGTCAGGTGAATGAATGG + Intergenic
1094280482 12:28732115-28732137 CTGTTCCTCTGGGGAAAAGAAGG + Intergenic
1094404210 12:30097652-30097674 ATGTTGTTCTGTAGAATCGATGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097376376 12:58848197-58848219 ATGTGTGTGTGGAGAATAGAGGG - Intergenic
1099115138 12:78614664-78614686 CTTTTGGTCTGGAGCATGAAAGG + Intergenic
1099236972 12:80093584-80093606 CTGTTGGAGTGGAGTATATAGGG + Intergenic
1100557602 12:95711603-95711625 CTGTTGAACTGGTGAGTAGAAGG + Intronic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1101041925 12:100763991-100764013 CTGTTGGGGTAGAGAATAGCAGG + Intronic
1104292430 12:127482582-127482604 TTGTGGGTCTGGATAATAGTTGG - Intergenic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1105699972 13:22928212-22928234 ATGTAGGGCTGGAGAATTGATGG + Intergenic
1107191829 13:37597275-37597297 CATTTGGGCTGGAGGATAGAGGG + Exonic
1107319118 13:39166955-39166977 TTGTTGGTCGGGAGTCTAGAAGG - Intergenic
1107798022 13:44074762-44074784 CTGTGGGCCTGGAAAATTGAAGG - Intergenic
1108602614 13:52007728-52007750 CAGTTGGTCAGGAGTACAGATGG - Intronic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1109747696 13:66647926-66647948 CTGTGGGCCTGGGGAAGAGACGG + Intronic
1110598018 13:77340316-77340338 CAGTTGGTATAGAGAAAAGAGGG + Intergenic
1110796540 13:79645137-79645159 CAGGTGCTTTGGAGAATAGAGGG - Intergenic
1112651812 13:101407717-101407739 CTATTTGTCGGGAGAACAGAGGG + Intronic
1114975017 14:28085091-28085113 CAGTTGCTCTGAATAATAGACGG - Intergenic
1116613906 14:47109362-47109384 CAGTTGGTCTGGACAAAAGCTGG - Intronic
1116962186 14:50977912-50977934 CTCTTGGGCTGGAGAAGACAGGG - Intronic
1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG + Intronic
1118291936 14:64534802-64534824 ATGTTGGCCTGAAGAAAAGATGG - Intergenic
1118988888 14:70780262-70780284 TTGTTGGGCTGGAGGATAGAAGG + Intronic
1125399498 15:39285447-39285469 GAGTTGCTCTGGAGTATAGATGG - Intergenic
1126156642 15:45571704-45571726 CTTTTGGTCTGGAGAATCTTTGG + Intergenic
1127625094 15:60772668-60772690 CTGTTGCTCTACAGAAAAGATGG + Intronic
1127844285 15:62856323-62856345 TGTTTGGTCTGGGGAATAGAGGG - Intergenic
1128968478 15:72085671-72085693 GTGGTTGTCTGGAGAAAAGAAGG + Intronic
1129272176 15:74424825-74424847 CTGCTGGGCTGGAGAACAGCTGG - Intronic
1129882666 15:79017451-79017473 CTGTAGGTCTGCAGGATAGTGGG + Intronic
1131333413 15:91523740-91523762 CTGTTGGTCTGGGAAGCAGATGG + Intergenic
1132984410 16:2756793-2756815 CTGTGTGTCTGGGGCATAGATGG + Intronic
1134813634 16:17188139-17188161 CTGGAGGTTTGGAGAATAGGGGG + Intronic
1135900885 16:26458861-26458883 CTGCTGGTATGGAAAATAGATGG + Intergenic
1137607867 16:49798810-49798832 CTGTTGCCCTGGAGAATTGTAGG + Intronic
1137691904 16:50434307-50434329 ATGATGGTCTGGAGAATGGCAGG + Intergenic
1138104612 16:54281264-54281286 CTGTAGTTCCGGTGAATAGAAGG + Intergenic
1138502200 16:57454049-57454071 CTGTTGGGCTGTATAATGGAGGG + Intronic
1142929831 17:3274285-3274307 CTGTTTGTCTGTAGAAGAAATGG - Intergenic
1146821461 17:35986228-35986250 CTGTTTATTTGGAGACTAGAGGG + Intronic
1146821591 17:35987068-35987090 CTGTTCATCTAGAGACTAGAGGG + Intronic
1148152936 17:45406922-45406944 CAGATGGGCTGGAGAATGGAGGG + Intronic
1150494698 17:65598244-65598266 CTGTTGGTCAGGAGAGGATAGGG + Intronic
1153737906 18:8091661-8091683 CTGATTATCTGTAGAATAGATGG + Intronic
1154030112 18:10746151-10746173 TTTGTGGTATGGAGAATAGATGG - Intronic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1155488335 18:26371702-26371724 CTCTAGGTCTGGTGAACAGATGG + Intronic
1155674254 18:28410272-28410294 CAATTGCTCTGGAGAACAGAGGG - Intergenic
1156706036 18:39883551-39883573 CTGGTGATCTGGTGAAAAGATGG + Intergenic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1159808328 18:72983063-72983085 TAGTTGGTTTGGAGCATAGAAGG - Intergenic
1162332294 19:10037735-10037757 CTGTGAGTCTGGGGAATGGAGGG + Intergenic
1164761176 19:30729457-30729479 CTGTTGGTCTTGAGTGTGGACGG + Intergenic
1164975161 19:32567596-32567618 CAGTTAGTCTGGTGAATAGCAGG + Intergenic
1165906894 19:39199840-39199862 GAATTGGTCTTGAGAATAGAGGG - Intronic
1166274251 19:41740980-41741002 TTGTTCATCTGGAGAAAAGATGG + Intronic
1167288063 19:48610001-48610023 CTGTTGGTGTGGGGAGTGGAGGG + Intronic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1167956541 19:53069842-53069864 CTGTGGGTTTGGACACTAGAAGG + Exonic
924982794 2:238365-238387 CTGTTGGTCTGAGGAATGGAGGG - Intronic
930050146 2:47208979-47209001 CTGTTTGAGTGGAGAATGGAAGG - Intergenic
931538137 2:63300836-63300858 CCCTTGGTCTGGAGAGTACATGG + Intronic
932285268 2:70526177-70526199 CTGATGACCTGGAGAATAGAGGG - Intronic
934105357 2:88690524-88690546 CTGTTGGTCTGCAAAGTTGAAGG - Intergenic
936156490 2:110050506-110050528 CTGTTTGCCTGCAGAATAGAGGG + Intergenic
936188200 2:110320938-110320960 CTGTTTGCCTGCAGAATAGAGGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936899891 2:117470662-117470684 CCCTTGGTCTGGAGAACACATGG - Intergenic
937616000 2:123922978-123923000 CTGTTTCTCTGGAGAACACAGGG - Intergenic
937983469 2:127628200-127628222 CTGTGGGTCTGGACAAATGAAGG - Intronic
939739529 2:145888167-145888189 CTGTTGTTCAGGAGAAAAGGTGG + Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
942287750 2:174437896-174437918 CTGTTGGTGTCTGGAATAGAAGG - Intronic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
947751946 2:232537493-232537515 CTGTTGGTCTGGAGAGAGTAAGG - Intergenic
948131774 2:235606276-235606298 CTGCTGTTGTGGAGAACAGAAGG - Intronic
948471342 2:238182509-238182531 CTTTTGGCCTGGAGTCTAGAAGG + Intronic
1170224525 20:13977159-13977181 ATGCTGGTCTAGAGATTAGAAGG + Intronic
1171191369 20:23161833-23161855 CTGTTGGGCTGGTGCATAGCAGG + Intergenic
1172849029 20:37947339-37947361 AGGGTGGGCTGGAGAATAGATGG + Intergenic
1174662616 20:52227286-52227308 CTGTTGGGCTGATGCATAGAAGG + Intergenic
1177312802 21:19419340-19419362 CTGTTGTTCTGGAGAGTTCAAGG + Intergenic
1180572039 22:16734219-16734241 CTGAGGGTCAGGAGTATAGATGG + Intergenic
1181734522 22:24871242-24871264 CCGTTGGTTTAGAGAAAAGAAGG + Intronic
1183342453 22:37289112-37289134 CTGGTCTTCTGGAGAAAAGATGG + Intronic
951485864 3:23209371-23209393 CTCTTTCTCTAGAGAATAGATGG + Intronic
953196353 3:40738026-40738048 CTGGTGGTCAGGAGAAGAGAAGG + Intergenic
955642845 3:61105116-61105138 GTGATTGTCTGGAGAAAAGAAGG + Intronic
956919108 3:73907465-73907487 CTTATTGTCTGCAGAATAGATGG - Intergenic
965033720 3:163406967-163406989 CTGTTTGTCCAGAGACTAGAGGG + Intergenic
966663184 3:182438500-182438522 CTCTTGATGTGGAGAATACAAGG + Intergenic
968379116 4:73821-73843 CAGTTGCTCTGAAGTATAGATGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969737218 4:8999934-8999956 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
972184831 4:36515974-36515996 CTGTTTCTCTGGAAACTAGATGG - Intergenic
972371419 4:38427200-38427222 CTATTTGTCTGGAGAAGAGAGGG - Intergenic
977837965 4:101667441-101667463 CTGTTGTTATGGAGAATGGTAGG - Intronic
979476787 4:121168006-121168028 TTTTTGATCTGGAGAATAAAAGG - Intronic
979713641 4:123810475-123810497 CTGTTGGTTTGGTGAAGAGGAGG + Intergenic
980642272 4:135596229-135596251 CTCTTGGTCTGGAGAGCACATGG + Intergenic
985371733 4:189292350-189292372 CTGTGGGTGTGCAGAATAAAAGG + Intergenic
986238735 5:5937710-5937732 CTGCTGAGGTGGAGAATAGAGGG + Intergenic
986289206 5:6385312-6385334 CTGCTGGTCTTGAGCAGAGAAGG - Intergenic
986730127 5:10629163-10629185 CTGCTGGTGTGGAGAATGAATGG + Intronic
989357149 5:40556348-40556370 CTGTCAGTTTGGAGAAAAGAAGG - Intergenic
991396331 5:66208681-66208703 CTGGTGTTGGGGAGAATAGAAGG + Intergenic
993800228 5:92324294-92324316 CTGATGATCTGGAGAACACAAGG - Intergenic
1000116997 5:158162612-158162634 CTGTTGGTCTGAGAAATAGGAGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1004044226 6:12011139-12011161 GTGTTGGTTTGGAGAGTGGAAGG - Intronic
1004405963 6:15333919-15333941 AGGATGTTCTGGAGAATAGAAGG + Intronic
1004798395 6:19115667-19115689 CTGTTGGTCTGTATTCTAGATGG - Intergenic
1008050845 6:46899113-46899135 CTGATGATCTGGGGAATGGATGG + Intronic
1008371012 6:50730622-50730644 CAGTTGCTCAGGATAATAGAGGG + Intronic
1009404355 6:63293456-63293478 CTGTTCATCTGGAAAATAGAGGG - Intronic
1010452568 6:76019226-76019248 CTGTTGGTCTGGAAACCAGCAGG + Intronic
1015147288 6:130001241-130001263 CTGTTGCTATAGATAATAGAAGG + Intergenic
1020586125 7:10070560-10070582 ATGTTTGTCTGGGGAATGGAGGG + Intergenic
1022032672 7:26506601-26506623 CTGTTGGTATTGAGAATGGTGGG + Intergenic
1024567490 7:50693998-50694020 CTTCTGTTATGGAGAATAGAGGG + Intronic
1026402898 7:70033884-70033906 CTGTTGGTCTGTAGCATATTAGG + Intronic
1027592114 7:80130737-80130759 CTGTGGGACTGGAGAATTGATGG + Intergenic
1028251893 7:88546982-88547004 CCGTTGGTCTGGAGAGCACATGG - Intergenic
1028351664 7:89857283-89857305 CCCTTGGTCTGGAGAGTACATGG + Intergenic
1028351678 7:89857369-89857391 CCCTTGGTCTGGAGAACACATGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031101593 7:117487014-117487036 TTGTTGATTTGGATAATAGAGGG + Intronic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1035698611 8:1620944-1620966 TTGTTTGTCTGGAGAGCAGAGGG - Intronic
1037124489 8:15330179-15330201 GATTTGGTCTGGAGAAGAGAAGG - Intergenic
1039411539 8:37359232-37359254 CTGTTTGTATGGAAAATATAGGG - Intergenic
1043398083 8:79857916-79857938 CAGCTGGTCTGGAGAACAGCCGG - Intergenic
1043583786 8:81743857-81743879 CTGTCTCTCTGGAGAAGAGAGGG + Intronic
1043813740 8:84775547-84775569 CTGTCTCTCTGGAGAAGAGAAGG - Intronic
1044452800 8:92357877-92357899 CTGTTGGTCGGTAGAATATCAGG + Intergenic
1045347157 8:101303594-101303616 CTCTTAGTCTGTAGAATAGTAGG - Intergenic
1050898850 9:10918959-10918981 TGGTTGGTCTGGTGAACAGATGG - Intergenic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1052215804 9:25964463-25964485 CTCTTGGTCTGGAGAGCACATGG - Intergenic
1052405182 9:28050564-28050586 CTGTTATTCTGGAGTATGGAGGG - Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1056540959 9:87571113-87571135 CTTTAGGCCTTGAGAATAGAAGG + Intronic
1058066289 9:100552059-100552081 CCTTTGGGCTGGAGAATAGGAGG + Intronic
1060156176 9:121321262-121321284 CTGCAGATCTGGAGAATCGAAGG + Exonic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061751363 9:132779660-132779682 CTACTGCTCTGGAGAGTAGATGG - Intronic
1193976529 X:88126871-88126893 GTGGTGGACTGCAGAATAGATGG + Intergenic
1196031333 X:111097426-111097448 CTGTTGGTCTGTAGAAGCGAAGG + Intronic
1197356190 X:125439423-125439445 CTCTTGGTCTGGAGAGCATATGG - Intergenic
1198440184 X:136655596-136655618 CTGTTGTTCTGGATACTAAATGG + Intronic
1200040742 X:153365421-153365443 ATATTGGTCAGGAGAAAAGAAGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1201470960 Y:14334529-14334551 CTGTAGGTGTGGGGAAAAGAAGG - Intergenic