ID: 1117992159

View in Genome Browser
Species Human (GRCh38)
Location 14:61444695-61444717
Sequence CACCCAGTTGGTGATGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117992159 Original CRISPR CACCCAGTTGGTGATGAGAC TGG (reversed) Intronic
901470204 1:9450692-9450714 CACCCAGTTTGGGTTGAGGCTGG - Intergenic
901554214 1:10018828-10018850 AACCAAGATGGTGATGAGAGTGG + Intergenic
902272243 1:15312969-15312991 CAACCAGTTTGTGACGAGCCTGG - Intronic
903569075 1:24291104-24291126 CCCACAGGTGGTGATGACACAGG + Intergenic
904068334 1:27773004-27773026 CACCTAGTTGGGGCTGAGATTGG - Intergenic
904294151 1:29506943-29506965 CCCCCAGTGCGTGCTGAGACAGG + Intergenic
905706109 1:40059903-40059925 CAACCAGTTAGTGGTGATACTGG + Intronic
906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG + Intronic
910441780 1:87260443-87260465 GAACTAGTTGGAGATGAGACTGG + Intergenic
913193489 1:116433318-116433340 CACCCAGCTGGTGATGGCTCAGG + Intergenic
914855288 1:151346247-151346269 CCCCCAGGTGGTGCTGAGGCTGG - Exonic
914948690 1:152090337-152090359 TACCCAGTTCTTCATGAGACTGG - Intergenic
915263466 1:154696815-154696837 CCCCTAGTTGGTGAGGAGACGGG - Intergenic
916595263 1:166236666-166236688 CACCCAGCTGGGGAAGAGACAGG - Intergenic
917606998 1:176641806-176641828 GACCAAGTTGATGATGAGGCTGG - Intronic
921609123 1:217190238-217190260 CACCCTCTTGGTGAAGGGACAGG - Intergenic
922718231 1:227887698-227887720 CACCCAGGTGGTGATGAGGGCGG + Intergenic
923883964 1:238134821-238134843 CATCCCATTGGTGATGATACGGG + Intergenic
1062797396 10:354798-354820 CACCACGTTGGAGATGATACTGG + Intronic
1062887940 10:1033399-1033421 CACCCAGTTGTACAGGAGACAGG - Intergenic
1067752705 10:48982522-48982544 CTCCTGGTTGGTGATGAGAGGGG + Exonic
1069951067 10:72018439-72018461 GGCCGAGATGGTGATGAGACAGG + Intergenic
1071416019 10:85441989-85442011 GACCCAGTTGCTTATGAGACAGG + Intergenic
1071547511 10:86539623-86539645 CACCCAGTTGCTGGTGAGGCTGG - Intergenic
1072191661 10:93081080-93081102 CAGCCCTTTGGTGATGAAACAGG + Intergenic
1073094556 10:100971734-100971756 CAACCAGTTGGGGATGGGATGGG - Intronic
1077644313 11:3909890-3909912 CACCCAGAGGGAAATGAGACTGG + Intronic
1077719014 11:4608348-4608370 TAGCCAATTGGTGATGAGACGGG + Intergenic
1077965730 11:7130907-7130929 CACCTGGTTGGTTATGATACTGG + Intergenic
1078127588 11:8583291-8583313 CACCCAGAAGGTGAAGGGACTGG - Intronic
1081156715 11:39702345-39702367 CACCCAGATGGAGAGGAGAGAGG - Intergenic
1084952387 11:72673902-72673924 AACCTAGTAGGTGATGAGGCTGG - Intronic
1085641095 11:78193303-78193325 CAGCTAGTTGGGGCTGAGACAGG - Intronic
1086165686 11:83775112-83775134 CACCCAGTTGTAAATGAGAACGG - Intronic
1086174693 11:83876717-83876739 CACCCACTTGGTGATAAGGTAGG - Intronic
1090009547 11:123034161-123034183 CATCCAGCTGGTGGAGAGACTGG + Intergenic
1090664285 11:128904728-128904750 CACCCAGTGGGTGTTGAGTGGGG + Intronic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG + Intronic
1092740292 12:11622153-11622175 AACCAAGATGGTGATGAGAGTGG + Intergenic
1093184361 12:16002991-16003013 CACCCAGTTTGTGGTGATAAGGG - Intronic
1094462564 12:30712935-30712957 CACCCTGTTGGTGGTCAGGCTGG + Intronic
1097589818 12:61560954-61560976 CACCCAGTTTGTGATGACTGTGG + Intergenic
1102578141 12:113870086-113870108 AACCAAGTTAGTGATGAGGCAGG + Intronic
1103308519 12:119986693-119986715 CACCCAACTGGTGGAGAGACAGG + Intergenic
1103329271 12:120142629-120142651 CACCCAGCTGGTGGTGCGGCAGG - Exonic
1109289697 13:60458634-60458656 CACACAGTTGGTGATGATCTAGG - Intronic
1112263008 13:97894838-97894860 CACCCAGTAGGTGATAAAGCAGG - Intergenic
1117984598 14:61374775-61374797 CTCCCAGTCTGTGATGAGAAGGG + Intronic
1117992159 14:61444695-61444717 CACCCAGTTGGTGATGAGACTGG - Intronic
1118458479 14:65966516-65966538 ACCACAGTTGGTGATGAGAAGGG - Intronic
1119469268 14:74883754-74883776 CACCCAGCTGTTGATAAGCCAGG + Intronic
1120023494 14:79556029-79556051 CACCCTGTTGCTGAAGAGAGGGG - Intronic
1120707454 14:87759614-87759636 CAACGAGTTGGTGATGGAACTGG - Intergenic
1122117638 14:99535732-99535754 CACCCAGTTGATGAAGAAATGGG - Intronic
1124355318 15:28991180-28991202 CACAGAGATGGTGCTGAGACAGG - Intronic
1127287754 15:57545829-57545851 CCCCCATTTGATGATGTGACTGG - Intronic
1129914541 15:79257210-79257232 CACCCAATTGGTGCTGGAACTGG + Intergenic
1132568826 16:635278-635300 CACCCCGTAGGTGATGAGCAGGG + Exonic
1134098269 16:11434011-11434033 CAGCCAGTTGGTCAGGAGGCAGG + Intronic
1135305021 16:21360320-21360342 CACCCAGGTGGTGAGTAGGCAGG + Intergenic
1136301766 16:29339513-29339535 CACCCAGGTGGTGAGTAGGCAGG + Intergenic
1137637486 16:49999490-49999512 CCCCCAGTTCTTCATGAGACTGG - Intergenic
1141538394 16:84699705-84699727 CCCCCAGTAGGTGAGGAGCCGGG + Intergenic
1142311505 16:89316874-89316896 CACCCAGATGGGGATGAGGTGGG - Intronic
1150272633 17:63876508-63876530 CTCCCAGCAGGTGATGAGTCTGG - Intronic
1150273972 17:63884257-63884279 CTCCCAGCAGGTGATGAGTCTGG - Intergenic
1150278283 17:63913785-63913807 CTCCCAGCAGGTGATGAGTCTGG - Intronic
1151997067 17:77616675-77616697 AACCAAGATGGTGATGAGAGTGG + Intergenic
1153980176 18:10302238-10302260 CAGCCAGTGAGTGATGAGTCAGG + Intergenic
1154172703 18:12062891-12062913 CACCCAGTGAGTGAGGAGTCAGG - Intergenic
1157158746 18:45292693-45292715 AACCCTGTTGGTGGTGGGACCGG + Intronic
1159426876 18:68300299-68300321 AATCCACTTGGTGATGAGAAGGG + Intergenic
1163815795 19:19463694-19463716 CACCTGGGTGGTGGTGAGACAGG + Intronic
1167767824 19:51495974-51495996 AACCTTGTTGGTGATGACACTGG + Intronic
1167980960 19:53274868-53274890 CACCCAGTCAGTGATGAGTGTGG + Intergenic
1167985433 19:53310492-53310514 CACCCAGTCAGTGATGAGTGTGG - Intergenic
925424116 2:3734639-3734661 GACCCAGTTGCAAATGAGACAGG + Intronic
927840745 2:26441694-26441716 CACACAGTGGGTGAAGAGAATGG + Intronic
928374951 2:30766423-30766445 CACCCAGCTGCTGCTGGGACAGG - Intronic
929557341 2:42933930-42933952 CACCCAGTTGGTGCTGGAAAAGG + Intergenic
938343144 2:130548692-130548714 CACACAGTTGGTCAGGAGACTGG + Intronic
938346689 2:130572030-130572052 CACACAGTTGGTCAGGAGACTGG - Intronic
942322707 2:174749952-174749974 CACCCAGTTGGGCATGACATGGG + Exonic
942417785 2:175776957-175776979 CACCCATTTTGTAATGAGGCAGG - Intergenic
944134471 2:196383646-196383668 CACCCAGTTGGCAATGACAAGGG + Intronic
946060385 2:216936167-216936189 CAGCTAGTTGGTGCTGGGACAGG + Intergenic
946935628 2:224717693-224717715 CATCCAGTAGGTGGTGAGATTGG - Intergenic
1175776753 20:61658654-61658676 GCCCCAGCTGGTGCTGAGACAGG - Intronic
1175993684 20:62802651-62802673 CACGCAGTGGGTGATGTGCCTGG - Intergenic
1180195231 21:46190042-46190064 CACCCACCTGGGCATGAGACTGG + Exonic
1181570177 22:23764164-23764186 CCCCCAGATGGTGAGGAGACAGG + Exonic
1184456100 22:44610127-44610149 CACCCAGCTGGTGCGGAGGCAGG + Intergenic
949445025 3:4125784-4125806 TACCCAGAGGGTGCTGAGACAGG - Intronic
961239849 3:125401129-125401151 CACCCAGCTGGTGAGGAATCTGG + Intergenic
968278457 3:197458290-197458312 CACCCAGCTGCTGAACAGACAGG - Intergenic
969278380 4:6152394-6152416 CAGCCAGTTGGTGGTGGGGCTGG - Intronic
970503595 4:16704009-16704031 CACCCAGTTGGGGAAAAGAGGGG - Intronic
970781745 4:19745864-19745886 GACGTAGTTGGTGATAAGACAGG - Intergenic
971501509 4:27323396-27323418 CACCCAGTTGGTGATAAATTTGG + Intergenic
983975828 4:173932977-173932999 CTGAAAGTTGGTGATGAGACGGG + Intergenic
987646196 5:20675646-20675668 CACCTAGCTGGTGCTGAAACTGG + Intergenic
988974091 5:36498152-36498174 CAGCCAGCAGGTGAGGAGACTGG - Intergenic
1000245764 5:159447246-159447268 CACCAAGGTAGTGATGAGAGTGG + Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1006319481 6:33312117-33312139 CACCGAGGTGATGATGAGAATGG - Intronic
1007239207 6:40413100-40413122 CACCCAGTGGGTGATGGGACTGG + Intronic
1017638338 6:156465563-156465585 CACCCAGTGAGGGCTGAGACTGG - Intergenic
1018458124 6:163971241-163971263 CACCCAGCTGGTGGGGACACTGG + Intergenic
1020076118 7:5260202-5260224 CCCTGAGTTGGTGATGAGATAGG - Intergenic
1024013109 7:45287528-45287550 CACCCAGTTGGTGTCCAGAGAGG - Intergenic
1025162094 7:56670102-56670124 TACCCAGTTGGTGAAAAGACTGG - Intergenic
1025202969 7:56973369-56973391 CCCTGAGTTGGTGATGAGATAGG + Intergenic
1025224433 7:57144452-57144474 TACCCAGTTGGTGAAAAGACTGG - Intergenic
1025668975 7:63603557-63603579 CCCTGAGTTGGTGATGAGATAGG - Intergenic
1025745234 7:64237043-64237065 TACACAGTTGGTGAAAAGACTGG + Intronic
1028830744 7:95324433-95324455 CACCCTCTTGGGGATGGGACTGG - Exonic
1034784674 7:153914902-153914924 GACCCAGTTATGGATGAGACTGG - Intronic
1035411229 7:158644174-158644196 CACCCAGGTGGTTAGGAGACTGG - Intronic
1038720950 8:30034887-30034909 AACCCAGGAGGTGATGATACAGG - Intergenic
1040290787 8:46123075-46123097 GACTCAGTTGATGATGAGGCAGG - Intergenic
1044535923 8:93356406-93356428 CCCCCAGTTAGTGAGGAGAGGGG - Intergenic
1047212959 8:122854439-122854461 AACCTAGTTGGTGGTGGGACTGG + Intronic
1047233510 8:123018262-123018284 CACCCAGATGGTGATTTAACTGG + Intronic
1048048166 8:130792657-130792679 GACCAAGGAGGTGATGAGACAGG - Intronic
1050527460 9:6558393-6558415 CTCCCTGTTGGTGATGGGAGGGG + Intronic
1053276224 9:36785587-36785609 TGCACAGTTGGTGATGACACTGG + Intergenic
1057282054 9:93720239-93720261 CACCCAGCAGGTGAGGAGATGGG + Intergenic
1057631385 9:96721465-96721487 CACCCAGTTTGTGCAGAGCCGGG + Intergenic
1185769585 X:2755425-2755447 AACCCAGATGGTGATGAGAGTGG - Intronic
1190005489 X:46732586-46732608 CACCCTGTTGGTGAGAAGATGGG + Intronic
1195232327 X:102862022-102862044 CGCCCAGTTTATGATGGGACTGG + Intergenic
1201300926 Y:12504204-12504226 AACCCAGATGGTGATGAGAGTGG + Intergenic