ID: 1117992764

View in Genome Browser
Species Human (GRCh38)
Location 14:61450995-61451017
Sequence TAGTGTTCCCATGAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117992764_1117992769 3 Left 1117992764 14:61450995-61451017 CCCACCTCTTCATGGGAACACTA 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1117992769 14:61451021-61451043 CCTAAGCTTTCAGAATTCTGTGG 0: 1
1: 1
2: 1
3: 14
4: 186
1117992764_1117992770 30 Left 1117992764 14:61450995-61451017 CCCACCTCTTCATGGGAACACTA 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1117992770 14:61451048-61451070 AGAATCTGTCCTAGAACTGATGG 0: 1
1: 0
2: 4
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117992764 Original CRISPR TAGTGTTCCCATGAAGAGGT GGG (reversed) Intronic
904771885 1:32885572-32885594 TATTGTCCCCATGAAGAAATGGG - Intergenic
907328656 1:53657399-53657421 CACTATTCCCATTAAGAGGTTGG + Intronic
918330357 1:183454399-183454421 TACTCCTCCCATTAAGAGGTGGG + Intergenic
918694251 1:187523673-187523695 TAGTTTTCCCATTATCAGGTGGG + Intergenic
920089810 1:203444346-203444368 TAGTCTTCCCACCAAGAGGCAGG - Intergenic
922315546 1:224438637-224438659 TAGTGTTCCAAAGAAAAGCTAGG - Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1065777727 10:29137185-29137207 TACTTCTCCCATGAAGAGATGGG - Intergenic
1067025432 10:42839608-42839630 TACAGTTCCCATGAAGGGGATGG + Intergenic
1069213263 10:65788208-65788230 AAATGTTTCCTTGAAGAGGTAGG - Intergenic
1069617246 10:69813938-69813960 TTGTGGTCCCAGGAGGAGGTGGG - Intronic
1069988299 10:72298731-72298753 TATTCTTCCCAGGAAGAGGAAGG + Intergenic
1070832995 10:79431685-79431707 TAGTGTTCCCCTCCAGATGTTGG - Intronic
1072220926 10:93326968-93326990 CACTTCTCCCATGAAGAGGTGGG + Intronic
1075300568 10:121319842-121319864 TTGTGTTCAAATGAAGAAGTTGG - Intergenic
1076484475 10:130807295-130807317 TGGTGTTCCTCTGAAGAGGGAGG - Intergenic
1077297297 11:1832185-1832207 GAGGGTTCCCTGGAAGAGGTGGG + Intronic
1077633647 11:3827351-3827373 CAGTGTTCCCAAGCAGAGGGGGG + Exonic
1081840661 11:46199105-46199127 CAGGGTTTCCAGGAAGAGGTTGG - Intergenic
1082171912 11:49015143-49015165 TTGAGTTCCCCTGAAGTGGTCGG + Intergenic
1083039302 11:59670173-59670195 TAGTGTTACCATCATGAGGCAGG - Intergenic
1088505634 11:110524371-110524393 TAGTGTTCCCATGAGCAAGAGGG - Intergenic
1088773561 11:113059720-113059742 TGGTGTTGCCATCAAGAGGCGGG - Intronic
1089443726 11:118535188-118535210 TAGAATTCCCAAGAGGAGGTGGG - Exonic
1089447051 11:118561673-118561695 TAGTGACCCCATTTAGAGGTGGG - Intronic
1094095608 12:26700759-26700781 CAGTGGTCCAAGGAAGAGGTGGG + Intronic
1096052263 12:48620965-48620987 TAATGTTGCCATGAACAGGAGGG - Intergenic
1098467509 12:70804601-70804623 TAGTATTTCTATGAAGATGTAGG - Intronic
1098807842 12:75042745-75042767 TAAAGTTCCAATGAAGTGGTTGG + Exonic
1099852727 12:88123107-88123129 TAGTGTGCCAGTGAAGAGGTTGG - Intronic
1100126500 12:91433278-91433300 TAGTTTTCCCAGGAAGAGTGAGG - Intergenic
1106453541 13:29906876-29906898 TAGTGTTCCCTTCAACAGGATGG + Intergenic
1106992208 13:35434791-35434813 TAGAGTGCACATTAAGAGGTAGG - Intronic
1107757848 13:43645077-43645099 TAGTTTTCCCATTAAGAATTTGG + Intronic
1108443791 13:50485459-50485481 TAATCTTCCCATGAATAGCTAGG - Intronic
1109770429 13:66963705-66963727 GAGTGTTCACATGAAGAGGGTGG - Intronic
1109947226 13:69452171-69452193 TAGTTTTCCCATCTAGAGATGGG - Intergenic
1113370941 13:109724949-109724971 AAGTTTTCCCATGAAGAACTGGG - Intergenic
1113525447 13:110971352-110971374 TAGTGATAACATTAAGAGGTGGG - Intergenic
1114156571 14:20110128-20110150 TATTGTTCCCTTTAAGAGATAGG + Intergenic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1117992764 14:61450995-61451017 TAGTGTTCCCATGAAGAGGTGGG - Intronic
1119735822 14:76981139-76981161 TCTTATTCCCATGATGAGGTTGG - Intergenic
1121299607 14:92860027-92860049 TAATATTTCCATGAAGTGGTTGG + Intergenic
1123426061 15:20171069-20171091 TACAGTTCCCATGAAGGGGATGG + Intergenic
1123535293 15:21177593-21177615 TACAGTTCCCATGAAGGGGATGG + Intergenic
1124660249 15:31542789-31542811 CATTGTTCCTTTGAAGAGGTAGG - Intronic
1124785861 15:32679931-32679953 TTGGGTTCCCATGAAAAGTTGGG + Intronic
1126141875 15:45445651-45445673 AAGTATTCCCATCAAGAGGAAGG - Intronic
1130248832 15:82281752-82281774 TTGTATTCCTAGGAAGAGGTTGG - Intronic
1130451226 15:84054400-84054422 TTGTATTCCTAGGAAGAGGTTGG + Intergenic
1133699507 16:8295859-8295881 AAGTCTCCCCAGGAAGAGGTGGG + Intergenic
1136858193 16:33678449-33678471 TACAGTTCCCATGAAGGGGATGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137772813 16:51030662-51030684 GAGTGTTGCCATGAAAAGGTGGG + Intergenic
1138157863 16:54722524-54722546 GAGTGGACACATGAAGAGGTGGG + Intergenic
1139321706 16:66119662-66119684 GAGTGTTCCCATCCAGAGGAGGG + Intergenic
1141803140 16:86324358-86324380 TAGTGGTGCCATGAAGAGTGGGG - Intergenic
1203119759 16_KI270728v1_random:1526918-1526940 TACAGTTCCCATGAAGGGGATGG - Intergenic
1144031325 17:11325786-11325808 CAGTGGTACAATGAAGAGGTTGG + Intronic
1144811213 17:18000563-18000585 TAGTGTTCCACTGAATAAGTTGG + Intronic
1144951979 17:18999345-18999367 TGGTGCTCCCATGCAGGGGTAGG + Intronic
1145924613 17:28636941-28636963 TAATGTTCCTGTGGAGAGGTGGG - Intronic
1146045002 17:29497626-29497648 TAGTTTACACAAGAAGAGGTAGG + Intronic
1152587054 17:81193832-81193854 TGGAGTTCCCATGTAGAGGTGGG - Intronic
1153827913 18:8893767-8893789 AAGTGTTTAAATGAAGAGGTTGG + Intergenic
1158624199 18:59057470-59057492 TTGTGTGACCTTGAAGAGGTAGG - Intergenic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925665377 2:6249360-6249382 TACTGTGCCCATGAGGAAGTGGG - Intergenic
927186823 2:20488035-20488057 TGCTGTCCCCATGAAGAGGAGGG - Intergenic
927504207 2:23602748-23602770 GAATATTCCCATGTAGAGGTCGG - Intronic
931122419 2:59234610-59234632 TATTGTTCCCATGATGTGCTGGG + Intergenic
931549969 2:63432544-63432566 TAATGTGCACATGCAGAGGTAGG + Intronic
937955070 2:127417528-127417550 AAGTCTTCCCAGGAACAGGTAGG + Intergenic
939647401 2:144717416-144717438 TATTGCTGCCATGAATAGGTGGG + Intergenic
940111573 2:150160677-150160699 TAGTTTCCCCATGAACAGGATGG - Intergenic
941824826 2:169883502-169883524 CATTCTTCCCATCAAGAGGTGGG - Intronic
941826394 2:169902380-169902402 TAGAGTTCACATGAAGAGAATGG - Intronic
941863188 2:170306334-170306356 CACTTTTCCCATTAAGAGGTGGG - Intronic
943172815 2:184425371-184425393 TAGTGTTCAGATGAACATGTAGG - Intergenic
1169490311 20:6065583-6065605 CAGTCTTCCCATCAAGAGGGAGG - Intergenic
1169745742 20:8940810-8940832 TATTATTCCCATTTAGAGGTGGG - Intronic
1170715544 20:18828125-18828147 TACTCCTCCCATCAAGAGGTGGG + Intronic
1170819689 20:19746123-19746145 CACTTTTCTCATGAAGAGGTTGG - Intergenic
1171446242 20:25206704-25206726 TTCTGTTCCCATGAACAGTTTGG + Intronic
1175004674 20:55669714-55669736 TATTGTTCCCATTAACAGTTCGG - Intergenic
1175851792 20:62097696-62097718 GAGGGTTCCCAGGAAGAGGGTGG + Intergenic
1178438815 21:32582129-32582151 TAGCGTCCCCATAAAGATGTGGG - Intronic
1179080474 21:38166154-38166176 TAGTGGTACCATTAAGAGGGTGG + Intronic
1181942248 22:26487325-26487347 AAGTCTTCTCATGTAGAGGTAGG - Intronic
950663185 3:14479620-14479642 GGGTGTTTCCATGGAGAGGTGGG + Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
955071961 3:55579099-55579121 AACTGTTCCCATAAAGAAGTGGG - Intronic
959977586 3:112479393-112479415 TAATGTTTCCAGGAAGAGGGGGG - Intronic
961516273 3:127439332-127439354 AAGTGCAGCCATGAAGAGGTGGG - Intergenic
963128304 3:141835145-141835167 GAGTGGACCCATGAAGAGGCAGG + Intergenic
963361117 3:144273034-144273056 CAGTGTTTCCATAAAGAGGGCGG - Intergenic
964477504 3:157110043-157110065 TAGTGTCCCTATGAAGACCTGGG - Intergenic
965957149 3:174384756-174384778 TAGTGTTCCACTGAACAGGATGG + Intergenic
966430502 3:179827272-179827294 GAGTGTCCTCAGGAAGAGGTAGG - Intronic
970058424 4:12001410-12001432 TAGTGATCACATGAGGAGGAAGG + Intergenic
971165720 4:24181360-24181382 TAGTTTTCCCACGAATAGATAGG + Intergenic
972274044 4:37540771-37540793 TATTGGCCCCATGTAGAGGTGGG + Intronic
975453194 4:74554409-74554431 TTTTGTTACCATGGAGAGGTAGG + Intergenic
980175003 4:129333874-129333896 TAGTGTTACCATGTAGAAATTGG + Intergenic
980876201 4:138664921-138664943 CAGTCCTCCCATGAAGAGGTGGG + Intergenic
981797092 4:148607854-148607876 TAGTGTTCCCAACAGGAGGAAGG - Intergenic
982066448 4:151658656-151658678 CACTCTTCCCATCAAGAGGTGGG - Intronic
984875432 4:184363476-184363498 CACTTTTCCCATCAAGAGGTAGG - Intergenic
985303642 4:188515368-188515390 TAATGTTAATATGAAGAGGTTGG + Intergenic
985928334 5:3035076-3035098 TCGTGTCCCTATGAAGAGGGGGG + Intergenic
990454640 5:55973290-55973312 TACTCTTTTCATGAAGAGGTGGG + Intronic
991484779 5:67123657-67123679 AAGTGTTCACTGGAAGAGGTAGG - Intronic
994083860 5:95737429-95737451 GATTGTTCACATGAAGATGTGGG + Intronic
997727927 5:136137638-136137660 GTGTGTTCCCAGGAAGAGGGGGG + Intronic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
999690987 5:154145693-154145715 TATTATTCCCATGAGAAGGTAGG + Intronic
1000272975 5:159704386-159704408 CAGAGTTCACATGAAGACGTGGG - Intergenic
1004144369 6:13051248-13051270 TAGAGCTCACATGCAGAGGTAGG - Intronic
1005927328 6:30454116-30454138 GAGTGTTGCCATGAAAAGGCTGG - Intergenic
1005930856 6:30482496-30482518 GAGTGTTGCCATGAAAAGGCTGG - Intergenic
1010747024 6:79575097-79575119 TATTCTTCCCATTGAGAGGTAGG - Intergenic
1012374850 6:98549061-98549083 GAATGTTCCCATGAATAGGTAGG + Intergenic
1013503755 6:110778628-110778650 TAGTGTTGCCACAAAGAGGATGG - Intronic
1015816244 6:137213994-137214016 TGCTCTTCCCATGAAGAGGTTGG - Intronic
1016394032 6:143603633-143603655 TAGTGTTTCCAGGAAGATCTGGG - Intronic
1018127211 6:160693031-160693053 TAGTCCTCCCATGGAAAGGTGGG + Intergenic
1018367756 6:163138768-163138790 CAGTGTTGCAATGAACAGGTAGG - Intronic
1023580611 7:41678358-41678380 TTGTGTACACATGAAGAAGTAGG - Intergenic
1030425695 7:109374428-109374450 TTGTGTACCCATGAAAAAGTGGG - Intergenic
1034874770 7:154715476-154715498 AAGTGTTCCAATGATAAGGTCGG - Intronic
1036284202 8:7429554-7429576 TAATCTTCCCTTGAAGAGTTGGG + Intronic
1036337274 8:7881976-7881998 TAATCTTCCCTTGAAGAGTTGGG - Intronic
1045410260 8:101910171-101910193 AAGTGGTCCCAAGAAGAGGATGG + Intronic
1045497092 8:102717960-102717982 AAGTGTTCCCATGAAGGGTGAGG - Intergenic
1046566096 8:115903450-115903472 CAATCTTCCCATCAAGAGGTGGG + Intergenic
1047037205 8:120953202-120953224 TCATGTGACCATGAAGAGGTGGG + Intergenic
1051307349 9:15726151-15726173 TTGTGTCCACATGAAGGGGTTGG + Intronic
1052341404 9:27367586-27367608 TTGTGGTCTCATGAAGAGCTAGG - Intronic
1052642280 9:31184054-31184076 TAGAGTTCCCATGCATGGGTAGG + Intergenic
1055235213 9:74113706-74113728 CAGTGTTTCCCTGAAGTGGTGGG + Intergenic
1055566894 9:77578761-77578783 TTTTGTCCCTATGAAGAGGTAGG + Intronic
1056237643 9:84611005-84611027 CATTCTTCCCATAAAGAGGTAGG - Intergenic
1056280653 9:85038363-85038385 TAGTGTTACCAGGCAGAGCTTGG - Intergenic
1056999378 9:91493341-91493363 TAGTGTATTCAAGAAGAGGTAGG - Intergenic
1058880387 9:109280613-109280635 CAGTTTTCCCAAGGAGAGGTGGG - Intronic
1059330705 9:113533764-113533786 CAGTGTTCCCATGTAAAGGTGGG - Intronic
1061201972 9:129143256-129143278 TAGTCTTCCCAGGAAGTGGGAGG - Intronic
1190280861 X:48928917-48928939 TAGTGTTTGCAGGAAGAGGGAGG + Intronic
1191054922 X:56232006-56232028 TCGTGTTACCATGGAGAGGTAGG + Intergenic
1192005446 X:67207162-67207184 TAGTGTTACCATGCATAGGTAGG - Intergenic
1193968436 X:88019687-88019709 TAGCATTCCCAGGCAGAGGTAGG - Intergenic
1196273968 X:113744584-113744606 TAGTGTACCTATTAAGATGTAGG - Intergenic
1197281471 X:124541784-124541806 TACTGCTCTCATCAAGAGGTGGG + Intronic
1200729385 Y:6716852-6716874 TACTGTTCCCACAAGGAGGTGGG - Intergenic
1200749253 Y:6929618-6929640 TAGTGTTCCCATCAGGAGCTGGG - Intronic