ID: 1117993461

View in Genome Browser
Species Human (GRCh38)
Location 14:61457463-61457485
Sequence GGAGCATGAGGGAGTCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 1, 2: 2, 3: 41, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117993461_1117993469 26 Left 1117993461 14:61457463-61457485 CCAAGAGGACTCCCTCATGCTCC 0: 1
1: 1
2: 2
3: 41
4: 290
Right 1117993469 14:61457512-61457534 CTTGCAAGAGTAAAAGAAACAGG 0: 1
1: 0
2: 1
3: 31
4: 328
1117993461_1117993465 -2 Left 1117993461 14:61457463-61457485 CCAAGAGGACTCCCTCATGCTCC 0: 1
1: 1
2: 2
3: 41
4: 290
Right 1117993465 14:61457484-61457506 CCCTCCTTTTGCTTTGCCATAGG 0: 1
1: 0
2: 0
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117993461 Original CRISPR GGAGCATGAGGGAGTCCTCT TGG (reversed) Intronic