ID: 1117996514

View in Genome Browser
Species Human (GRCh38)
Location 14:61483133-61483155
Sequence TTTGGAGGGATGGCCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117996514_1117996520 -4 Left 1117996514 14:61483133-61483155 CCATCAGTGGCCATCCCTCCAAA 0: 1
1: 0
2: 1
3: 12
4: 143
Right 1117996520 14:61483152-61483174 CAAATGGACAGATACAGCATTGG 0: 1
1: 0
2: 2
3: 17
4: 175
1117996514_1117996522 30 Left 1117996514 14:61483133-61483155 CCATCAGTGGCCATCCCTCCAAA 0: 1
1: 0
2: 1
3: 12
4: 143
Right 1117996522 14:61483186-61483208 ACTATGCAGATGCAGCTTTTTGG 0: 1
1: 0
2: 2
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117996514 Original CRISPR TTTGGAGGGATGGCCACTGA TGG (reversed) Intronic
900528018 1:3138595-3138617 TTTGGCTGGAAGGCAACTGAGGG + Intronic
901217244 1:7561677-7561699 TGGGGAGGGGTGGCCTCTGACGG - Intronic
901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG + Exonic
902725005 1:18329630-18329652 TTTGGAGGGCTGGGCAGTCAAGG + Intronic
903339962 1:22647617-22647639 TTTGGACGTGTGGCCACAGAAGG - Exonic
903407077 1:23106803-23106825 TGGGGAAGGATGGACACTGATGG - Intronic
904801755 1:33097906-33097928 ATTGGAAGGATGGCTGCTGATGG + Intronic
905326176 1:37153457-37153479 CTTGGAGGGAGGGAGACTGAGGG - Intergenic
907434950 1:54439600-54439622 TCTCCAAGGATGGCCACTGATGG + Intergenic
912684833 1:111754273-111754295 TTTGAAGGAATGGAGACTGATGG - Intronic
915447296 1:155981051-155981073 TCTGGCTGGATGGCCACTTAAGG - Intronic
923925695 1:238624849-238624871 ATTGGAGGGATGTCCACGGAGGG - Intergenic
1063516325 10:6699596-6699618 TTTCTTGGCATGGCCACTGAGGG - Intergenic
1063910167 10:10821296-10821318 TGTGTAGAGTTGGCCACTGAAGG + Intergenic
1073600408 10:104840811-104840833 TTTGGAGGCATGTCCTCTGAAGG + Intronic
1075116017 10:119627748-119627770 TTTGGAGGGATTGCTATTCAAGG - Intergenic
1076535810 10:131176100-131176122 TTTGGAGGGACACCCACTGCTGG - Intronic
1077287698 11:1775106-1775128 TTTGGAGGGAGGGCAGGTGAGGG + Intergenic
1077890276 11:6413290-6413312 TTTGTTGGGATGGTCAGTGAGGG - Intronic
1078433122 11:11302841-11302863 TTTTGAAGGACAGCCACTGAGGG - Intronic
1079454500 11:20624965-20624987 TTTGCAGGTGTGGACACTGAGGG + Intronic
1079514807 11:21254820-21254842 TGTGCCGAGATGGCCACTGAGGG + Intronic
1081875374 11:46404797-46404819 TTTGGGGGGATGGGGACAGAGGG - Intronic
1089606707 11:119645534-119645556 AGTGCAGGGATGGCCACTGTTGG - Intronic
1089663377 11:120000625-120000647 AGGGGAGGGAAGGCCACTGAAGG - Intergenic
1091399830 12:175058-175080 CTGGGAGGGCTGGCCACTGGGGG + Exonic
1092297008 12:7208747-7208769 TTTGGATGGATTGAGACTGAAGG + Intronic
1092687710 12:11070271-11070293 TTTGGTGGAATGCCCACAGAAGG - Intronic
1100961301 12:99965606-99965628 TTTGGTGGGAATGCCACAGAGGG - Intronic
1101443935 12:104723716-104723738 TTTCCAGGGAGGGCCACTTAGGG - Intronic
1103700293 12:122845712-122845734 TCTGGATGGATGGTCTCTGAGGG - Intronic
1104345614 12:127993960-127993982 TTGGGAGAGATGACCTCTGATGG - Intergenic
1104611840 12:130235173-130235195 CTTGGAGGGAAGGGCAGTGAAGG + Intergenic
1105407502 13:20144329-20144351 TGTTGAGTGACGGCCACTGAAGG - Intronic
1105819057 13:24063485-24063507 TTGGGAGGAAAGGCCACCGAGGG - Intronic
1106311705 13:28560496-28560518 TTTGGATGGAAGGCCTCAGATGG + Intergenic
1110162336 13:72393346-72393368 TTTGGTGGTAAGGCCACTGAAGG - Intergenic
1111553491 13:89848594-89848616 TTAGAAGGTATGGCCTCTGAGGG - Intergenic
1114966927 14:27973705-27973727 TTTGGAGGAATGGAAAGTGAAGG + Intergenic
1117996514 14:61483133-61483155 TTTGGAGGGATGGCCACTGATGG - Intronic
1119910244 14:78343375-78343397 TTGGGAGAGATGCCCACAGATGG - Intronic
1120657325 14:87207909-87207931 CTTGGAGAGATTGCCAATGAGGG - Intergenic
1121552644 14:94814007-94814029 TTTGTATAGATGGCCACTGCTGG + Intergenic
1125790871 15:42364904-42364926 TTTGGAGGGATGAGAAGTGAAGG + Intronic
1126491454 15:49241377-49241399 TAGGAAGGGATGTCCACTGAAGG + Intronic
1129314702 15:74734458-74734480 TTAGGTGGGATGGCCAAGGAAGG - Intergenic
1130086614 15:80782941-80782963 CTTGGAGTGAAGGCCAATGAGGG + Intronic
1131278987 15:91005844-91005866 CATGGATGGATGGCAACTGAGGG - Intronic
1132271367 15:100528946-100528968 TTTGGAGGGTGGGTCTCTGAAGG - Exonic
1132581647 16:687441-687463 TCTGCAGGAAAGGCCACTGAGGG - Intronic
1134657843 16:15960630-15960652 TACGGAGGGATGTCCACAGAAGG + Intronic
1135996495 16:27253438-27253460 TTTCGAGAGATGGGCAATGAGGG - Intronic
1137916939 16:52441819-52441841 TGTGGAGAGCTGCCCACTGAAGG - Intronic
1138014015 16:53412817-53412839 TGTGGAGGGAAGGGCACTGGCGG + Intergenic
1139037170 16:62961039-62961061 CTTGGATGGATGGTCACTGTAGG + Intergenic
1139714311 16:68800439-68800461 TTTGCAAGGGTGGCCCCTGATGG + Intronic
1143017813 17:3900540-3900562 ATGGGAGGGAAGGCCAGTGAGGG - Intronic
1144030245 17:11313872-11313894 GTTGGATGGCCGGCCACTGAAGG + Intronic
1147186478 17:38716021-38716043 GTTGGTGGGGTGGCCCCTGAAGG - Intronic
1148793912 17:50188254-50188276 TTGGGAGAGATGGCCACAGTGGG - Intronic
1157806102 18:50658703-50658725 TTTGGAGAGCTGGGCCCTGAGGG + Intronic
1158567515 18:58567817-58567839 TTAGGAGAGAGGACCACTGAGGG - Intronic
1159541645 18:69785038-69785060 TTTGATGGGATGGCAAATGACGG + Intronic
1161080077 19:2306179-2306201 TTTGGAGAGAAGGAGACTGAGGG + Intronic
1161444716 19:4311723-4311745 TTTGGGGGCATGGCCACAAAGGG - Intronic
1162617094 19:11810760-11810782 TGTGTTGGGATGGCCAGTGAAGG + Intergenic
1162712838 19:12608941-12608963 TGTGTTGGGATGGCCAATGAAGG + Intronic
1164232364 19:23301824-23301846 TCTGGAGGTATCACCACTGAAGG + Intergenic
1164485479 19:28652329-28652351 GTTGGGAGGATGGTCACTGAAGG - Intergenic
1164558318 19:29270056-29270078 GCTGGAGGGAGGGCCACTGTGGG + Intergenic
1164707553 19:30331740-30331762 TTTGGAGGGAAAGGCAGTGATGG - Intronic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
925189993 2:1874962-1874984 TCTGGAGGGAGGACCACGGATGG - Intronic
928226443 2:29452689-29452711 TGTGGAGAGGTGGCAACTGATGG - Intronic
928891735 2:36212221-36212243 TTTAAAGGGATTACCACTGAAGG + Intergenic
930022626 2:47010661-47010683 TCTGGAGGCATGGCCAATGGCGG - Intronic
932059611 2:68482800-68482822 TTTGGTGGCATGCCCACTGGGGG + Intronic
936574376 2:113641282-113641304 TTTGGAGGGGGGGCCACTGGAGG - Intronic
940856206 2:158730490-158730512 TGTGGGGGGATGGCTAGTGAGGG + Intergenic
943744955 2:191452507-191452529 CTTGGAGTGTTGGCCACTTATGG - Intergenic
947574894 2:231265243-231265265 TTTGGGTGGATGGCCACTAGTGG - Intronic
948183401 2:236000757-236000779 TTTGCAGTGAGGGCCACTAAGGG + Intronic
948634763 2:239328003-239328025 TGTGGAGGGATGTGCAGTGAGGG - Intronic
949008138 2:241662085-241662107 TCGGGAGAGTTGGCCACTGAAGG + Intronic
1170803526 20:19610455-19610477 TCTTGAGGGATAGCCACAGAGGG + Intronic
1170817076 20:19722349-19722371 CCTGGAGGGATGGCCAGGGAAGG + Exonic
1171947191 20:31389202-31389224 GTTGGATGGATGGACACTGCCGG - Exonic
1174360344 20:50024967-50024989 GTTGGAGGGATGGGAAGTGATGG - Intergenic
1174905445 20:54545420-54545442 ATTGGAGGGTTGGGCACTCATGG + Intronic
1175497336 20:59423904-59423926 TTTGGGGGGAGGACCACAGAAGG + Intergenic
1178273171 21:31212316-31212338 CTTGGATGCATGGCAACTGAGGG + Intronic
1180166683 21:46034165-46034187 TTTGTAAGGATTCCCACTGACGG + Intergenic
1182077263 22:27503534-27503556 TTTGAAGGGATGGTCAAAGAAGG + Intergenic
1182104583 22:27680425-27680447 CTGGGATGGATGCCCACTGATGG - Intergenic
1183772371 22:39938171-39938193 TTTGGAGGGAGGGGTAGTGAAGG - Intronic
1184368211 22:44066228-44066250 TTTTTAGTGATGGCCAGTGAAGG + Intronic
953370858 3:42387490-42387512 TGTGGAGGGAGAGCCACAGAGGG + Intergenic
953783948 3:45896587-45896609 TTTGGAGGAATAGCCCTTGAGGG + Intronic
959433023 3:106278286-106278308 TTTGGCAGGAAGACCACTGATGG - Intergenic
963477727 3:145828451-145828473 TCTGGAGGTATCACCACTGAAGG + Intergenic
966299654 3:178463603-178463625 TTTGGCTGCATGGCCACTGATGG - Intronic
967839679 3:193995224-193995246 GTGGGAGGGATGGCCCCTGTGGG + Intergenic
968067644 3:195767678-195767700 TTTTGGGGGGTGGCCAGTGATGG - Intronic
969106320 4:4809551-4809573 TTTTGAGGAATGGCCAATAAGGG - Intergenic
975658354 4:76663861-76663883 GTTGGAACTATGGCCACTGAAGG - Intronic
981648858 4:147032407-147032429 TTTGGAGTGATGGACTTTGAAGG + Intergenic
982591933 4:157324482-157324504 TTTGGAGGGAAGGTCAAGGAAGG + Intronic
985067613 4:186138722-186138744 TTGGGGGGGAAGGCCACAGAAGG + Intronic
989090216 5:37722705-37722727 TTCTGAGGGATGGCAACAGATGG - Intronic
989792497 5:45422488-45422510 TTTGGAGGTTTGGCCCTTGAGGG - Intronic
995782802 5:115795903-115795925 TTTGGTGTGAAGGCCACTGCTGG - Intergenic
997321100 5:132979300-132979322 TTTGGAAAGATGCCTACTGAGGG - Intergenic
1002164934 5:177338290-177338312 TCTGGAAGGAAGGTCACTGAGGG - Intronic
1002393074 5:178930951-178930973 TCAGGAGGGATGGACAGTGAAGG - Intronic
1002829796 6:809451-809473 CAGGGAGGGATGGCAACTGATGG + Intergenic
1003130702 6:3393002-3393024 TTTGGAGGGAGGGCAAAGGAAGG + Intronic
1003685879 6:8301591-8301613 TTTGGAAGGATGACTACAGAGGG - Intergenic
1006400661 6:33815304-33815326 TTTGAAGGGGGTGCCACTGAGGG + Intergenic
1007659835 6:43477410-43477432 ATTGGAGGACTGGCCACAGAAGG - Intergenic
1011221927 6:85063949-85063971 TTTGGAGGTATGGCCACAATTGG - Intergenic
1014477008 6:121886051-121886073 TTTGAAAGGAAGGCCACTGAAGG + Intergenic
1015202820 6:130601978-130602000 TTTGGAGGAATTGCCTCTGAGGG + Intergenic
1016838621 6:148504519-148504541 TTGTGAGGGAAGGCCACTGCTGG - Intronic
1018770066 6:166962699-166962721 TTTGGATAGATGGCCAGTAATGG + Intergenic
1019592917 7:1844622-1844644 TTTGGGGGGATGGTCACCAAGGG - Intronic
1022126161 7:27359599-27359621 CCTGGAGGGATGCCCAGTGAGGG - Intergenic
1024310769 7:47966899-47966921 GTTGGAGTGATGGGCACAGAAGG - Intronic
1026445688 7:70482614-70482636 TTTGGGGGGAGGGCCTCTGCAGG + Intronic
1027172912 7:75885495-75885517 TTTGGGGGGAGGACCACTGAAGG - Intronic
1032252094 7:130266815-130266837 TTTGTAGGGATGGCAGCTGAGGG - Exonic
1032422401 7:131793124-131793146 TTTGGAGGGATGGTGAGTAAGGG + Intergenic
1034822485 7:154229557-154229579 TGTGGATGGATTACCACTGAGGG + Intronic
1034833546 7:154330943-154330965 TCTTGAGGGAAGGCCACTGCAGG - Intronic
1035374420 7:158397956-158397978 ACCGGAGGGACGGCCACTGAGGG + Intronic
1035392452 7:158514284-158514306 TGAGGAGGGATGGCCACGAAGGG + Intronic
1043166064 8:76904176-76904198 TTTAGACGGATGGCCACAGTGGG + Intergenic
1048596752 8:135874799-135874821 TGTGGAGGGAAGGGCACTGTTGG - Intergenic
1049392130 8:142377083-142377105 CTTGGAGGGATGGGCTCTGAGGG - Intronic
1050282015 9:4060357-4060379 TTGAAAGGGATGACCACTGAAGG - Intronic
1050420163 9:5455576-5455598 TTTTGAAGGATGGCACCTGAAGG + Intronic
1051615854 9:19005964-19005986 TTTGGAGAGATGTCTACTCAAGG - Intronic
1052092440 9:24345595-24345617 ATGGGAGGGCTGGACACTGATGG + Intergenic
1054721107 9:68604896-68604918 TTTGGGAGGAAGGCCACAGAGGG - Intergenic
1056561524 9:87733971-87733993 TAAGGAGGGATGGACAATGAGGG + Intergenic
1059520281 9:114934343-114934365 GTTGGAGGAATGGCTACTGCTGG - Intergenic
1059633112 9:116145995-116146017 TTTGGAGGGCTGGCCACTGTTGG + Intergenic
1060345049 9:122808640-122808662 TTTGGAGATAGGGCCACTGAAGG - Intronic
1187747820 X:22428944-22428966 TTTTAAGGGATGCCCACAGAGGG - Intergenic
1188390717 X:29615979-29616001 TTTGAAGGGATGGGCATTAAAGG + Intronic
1189735190 X:44062965-44062987 TTTGGAGGGATGTGCCCTGGGGG - Intergenic
1189772145 X:44437493-44437515 TTGGGAGGGATGGACTTTGAAGG + Intergenic
1191863787 X:65687661-65687683 GCTGGAGGGATGGTCAGTGAAGG - Intronic
1192261244 X:69506795-69506817 ACTGGTGGGAAGGCCACTGAAGG + Intronic
1193437322 X:81491773-81491795 TTGAGAGGACTGGCCACTGATGG - Intergenic
1195709351 X:107761476-107761498 TTTGGAGACATGGCCACTGCTGG + Intronic
1196167621 X:112552679-112552701 TTCTGAGGGACTGCCACTGAGGG + Intergenic
1196368707 X:114951744-114951766 TGTGGAGGGATGACCACCGGAGG - Intergenic