ID: 1118001121

View in Genome Browser
Species Human (GRCh38)
Location 14:61524958-61524980
Sequence TCTTATTTTTAGGGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 311}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118001121_1118001130 10 Left 1118001121 14:61524958-61524980 CCTTCCATCCCCTAAAAATAAGA 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1118001130 14:61524991-61525013 GTTGGCCAGGGCAGTCCCATTGG 0: 1
1: 0
2: 1
3: 9
4: 154
1118001121_1118001128 -3 Left 1118001121 14:61524958-61524980 CCTTCCATCCCCTAAAAATAAGA 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1118001128 14:61524978-61525000 AGATAGGCTCTGAGTTGGCCAGG 0: 1
1: 0
2: 4
3: 14
4: 258
1118001121_1118001131 11 Left 1118001121 14:61524958-61524980 CCTTCCATCCCCTAAAAATAAGA 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1118001131 14:61524992-61525014 TTGGCCAGGGCAGTCCCATTGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1118001121_1118001132 12 Left 1118001121 14:61524958-61524980 CCTTCCATCCCCTAAAAATAAGA 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1118001132 14:61524993-61525015 TGGCCAGGGCAGTCCCATTGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
1118001121_1118001129 -2 Left 1118001121 14:61524958-61524980 CCTTCCATCCCCTAAAAATAAGA 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1118001129 14:61524979-61525001 GATAGGCTCTGAGTTGGCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 150
1118001121_1118001127 -8 Left 1118001121 14:61524958-61524980 CCTTCCATCCCCTAAAAATAAGA 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1118001127 14:61524973-61524995 AAATAAGATAGGCTCTGAGTTGG 0: 1
1: 0
2: 3
3: 23
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118001121 Original CRISPR TCTTATTTTTAGGGGATGGA AGG (reversed) Intronic
900105968 1:981163-981185 TCTTCCTTTCAGGGCATGGATGG - Intronic
900510766 1:3059813-3059835 TTTTCATTTTAGAGGATGGAAGG - Intergenic
901622785 1:10602201-10602223 TTTTATTTTTAGGGGCTGGAAGG - Intronic
901783155 1:11607981-11608003 TGTTTTTTTTAGTGGATGCATGG + Intergenic
902296585 1:15471714-15471736 TATAATTTTTAGGGGTTCGAAGG + Intronic
902567561 1:17322482-17322504 TCTTTTTTTTTGGGGGGGGATGG - Intronic
904302637 1:29564930-29564952 TCTTATATTTGGGAGATGAAAGG + Intergenic
904669328 1:32151161-32151183 TCTTTTTTTTAAAGGATGTAGGG + Intronic
905205490 1:36340783-36340805 TCTTGTGTTTAGGGGATGGTGGG - Exonic
906982074 1:50642267-50642289 TCTTATGTTTAGTGTTTGGATGG + Intronic
910553218 1:88499836-88499858 ACATATTTCTAGAGGATGGAAGG - Intergenic
911626891 1:100133871-100133893 TCTTATTTTTAGTAGAGAGAGGG - Intronic
911655585 1:100439282-100439304 TCTTTTTTGTAGGGGAAGGATGG + Intronic
916147305 1:161750918-161750940 TCTTTTTTTGGGGGGAGGGATGG - Intronic
916486210 1:165261321-165261343 TCCAGTTTTTAGTGGATGGAAGG - Intronic
917627105 1:176857486-176857508 TCCTGCTTTGAGGGGATGGAAGG + Intronic
917667809 1:177242266-177242288 TTTTATTTTTGGGGGACAGATGG - Intronic
918782372 1:188717808-188717830 TCCTTCTTTTAGGGGATGGTTGG + Intergenic
920493030 1:206433213-206433235 GGTTACTTATAGGGGATGGATGG + Intronic
923753984 1:236773413-236773435 GCTTCTTCTTAGGGGAAGGAAGG - Intergenic
924257393 1:242195972-242195994 TCTTATGTAAGGGGGATGGACGG + Intronic
924774083 1:247103808-247103830 GCTTAATTTTAGGGGAAGAAAGG + Intronic
1062885486 10:1012986-1013008 TCTTTTTTTTAGGGGGGAGATGG + Intronic
1063552641 10:7047638-7047660 TCTTATTTTCAGGGGCTTCAGGG + Intergenic
1063608027 10:7540039-7540061 TTTAAGTTTTTGGGGATGGAGGG - Intergenic
1064113028 10:12554715-12554737 TTTTTTTTTTAAGAGATGGAGGG + Intronic
1064258683 10:13767409-13767431 TTTTATTTTTAGTGGAAGCAGGG + Intronic
1065045384 10:21743642-21743664 TCTCATTTGGAGAGGATGGAGGG + Intergenic
1065300614 10:24317887-24317909 TTTCATTTTTAGGTGATGGCTGG + Intronic
1068295035 10:55059237-55059259 TCATATTTTTATGGGTTGGTAGG - Intronic
1068924176 10:62517629-62517651 TCTGCTCTTTAGGGTATGGACGG - Intronic
1070369952 10:75772845-75772867 TCTTATTTTTTGGGGGGGGTGGG + Intronic
1071107353 10:82113737-82113759 TGTTAATTTTAGGGGAAGCAAGG + Intronic
1071823635 10:89302750-89302772 TCTCATGTTTTGGGGATAGAAGG - Intronic
1072005222 10:91239114-91239136 TCTTATTTTTGGGGGGCGGAGGG + Intronic
1072096609 10:92187814-92187836 TCTCATTTCTAGTGGATTGAAGG - Intronic
1072958103 10:99904632-99904654 ACTAATTTTTAGAGGAGGGATGG - Intronic
1073296850 10:102445477-102445499 TTTTATTATTAGTGGGTGGAGGG - Intergenic
1074468827 10:113708280-113708302 TTTTTTTTTTAGGGGAAAGAGGG + Intronic
1077881189 11:6351744-6351766 TCATTTTTTGAGGTGATGGAGGG - Intergenic
1078092518 11:8275376-8275398 TTTTATGTTTAGGGGAGGTAAGG - Intergenic
1078223431 11:9370839-9370861 TCTTTTTTTTTGGAGATGGATGG - Intergenic
1079859842 11:25655111-25655133 TCTTACTTTAAGAGGATGAAAGG - Intergenic
1080071371 11:28092120-28092142 TCTTATTTTCAGGAAATGTATGG + Intronic
1082099047 11:48156757-48156779 TTTTATTTTTAGTGGAGGCAAGG + Intronic
1083082578 11:60109196-60109218 TCTTTTTTTCGGGGGGTGGAGGG - Intergenic
1083575589 11:63788732-63788754 TTTTATTTTTAGGGGAGACACGG - Intergenic
1084616710 11:70241140-70241162 TCTTTTTTTTTGGGGGGGGACGG + Intergenic
1085559993 11:77462821-77462843 TTTTTTTTTTTGGAGATGGAGGG - Intronic
1086089787 11:82993864-82993886 TCTTTTTTATGGGGGAAGGAAGG - Intronic
1086862978 11:91947166-91947188 TCTCATTTCTAGGGGCGGGAGGG + Intergenic
1087521689 11:99245785-99245807 TCTTTGTTGTAGGGGATGTACGG + Intronic
1088610903 11:111575619-111575641 TCTTATTTTTGGGGGGGGGGGGG + Intergenic
1088772089 11:113045060-113045082 TTTTATTTCTAAGGCATGGAAGG + Intronic
1090305848 11:125690321-125690343 TCTGATTTTTAGTAGATGTAAGG - Intergenic
1090945880 11:131429160-131429182 TCTGATTTTTAAGGGATTGAGGG + Intronic
1091734809 12:2911954-2911976 TTTTTTTTTTAAGAGATGGAGGG - Intronic
1092688493 12:11078927-11078949 TCACACCTTTAGGGGATGGAAGG + Intronic
1093764672 12:22949594-22949616 TCTTATATTTAAGAAATGGAAGG - Intergenic
1094459080 12:30673870-30673892 ACATATTTATAGAGGATGGAAGG - Intronic
1094564186 12:31584833-31584855 TCTTTTTTTTCGGGGAGGGTGGG - Intronic
1096128936 12:49141885-49141907 TTTTATTTTTAGCAGATGCAGGG + Intergenic
1096364544 12:51017287-51017309 TCTTATTTATAGTGGTTGCATGG - Intronic
1098484760 12:71007793-71007815 TTTTATTTTTGGGGAAGGGAGGG + Intergenic
1098537287 12:71607331-71607353 TCATCTTTTTGGGGGATAGAGGG - Intergenic
1098868111 12:75785081-75785103 TCATATATTTGGGGGCTGGAAGG + Intergenic
1101128456 12:101664009-101664031 TCTTATTTTTAGATGAAGGCAGG - Intronic
1103869904 12:124084030-124084052 TCTTTTTTTTAGGGGGAGGACGG + Intronic
1104143874 12:126013762-126013784 TCTTTTTTTTGGGGGGGGGATGG - Intergenic
1106077158 13:26470506-26470528 ACCTACTTTTAGGGGAGGGAAGG - Intergenic
1107083275 13:36397777-36397799 TCTTTTTTTTTGGAGATGAATGG - Intergenic
1107392467 13:39981515-39981537 TCTTCTTTTCAGGGGATGCTAGG + Intergenic
1108348267 13:49566827-49566849 TCTTATTTTCAGAGGAGAGAAGG - Intronic
1108478600 13:50844176-50844198 TCTTTTGTTTGGGGGATGCAAGG - Intergenic
1109646067 13:65258424-65258446 TCTTATTTTTAGGAGATATGTGG - Intergenic
1111885895 13:94019742-94019764 TCTTATTTGTAGGCTCTGGATGG + Intronic
1111964698 13:94848757-94848779 ACTTATTTTAATGGAATGGAGGG - Intergenic
1113220501 13:108096121-108096143 TTTTATTTTTAGTGGATGGGGGG + Intergenic
1115197630 14:30818529-30818551 TTTGGTTGTTAGGGGATGGAGGG + Intergenic
1115572215 14:34677342-34677364 TCTTTTTTGTAGGGGCTGGATGG + Intergenic
1117050971 14:51859475-51859497 TATTATTTTTAGAGGATGTTGGG - Intronic
1117562009 14:56950075-56950097 TGTGATTATTAGGGGATGGCTGG + Intergenic
1117585104 14:57193407-57193429 TCTGCTTTTTAGGGGATTGCTGG + Intergenic
1118001121 14:61524958-61524980 TCTTATTTTTAGGGGATGGAAGG - Intronic
1118440981 14:65811588-65811610 TCTGGTTTTTTGGGGAAGGAGGG - Intergenic
1118501580 14:66367006-66367028 AGATATTTTTAGGAGATGGAAGG - Intergenic
1118519555 14:66567097-66567119 ACATATTTTTGGGGCATGGATGG + Intronic
1119337466 14:73846065-73846087 TCTTATTTTTAGTGGAGACAGGG - Intergenic
1119976962 14:79035838-79035860 TTTTGTTTGTGGGGGATGGATGG + Intronic
1120223602 14:81764616-81764638 TTATATTTTTAAGGGATAGATGG - Intergenic
1121136557 14:91504149-91504171 TCTTTTTTTTAAGAGATGGAAGG - Intronic
1121981111 14:98454907-98454929 TCATATTTTTAGGGGGTTGGCGG + Intergenic
1122012662 14:98764386-98764408 TCATCTTTTTTGGGGATGGTTGG + Intergenic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1123464458 15:20505304-20505326 GCTTTTTTTTAGGGTATGTAAGG - Intergenic
1123653653 15:22495737-22495759 GCTTTTTTTTAGGGTATGTAAGG + Intergenic
1123680447 15:22758986-22759008 GCTTTTTTTTAGGGTATGTAAGG + Intergenic
1123744077 15:23304595-23304617 GCTTTTTTTTAGGGTATGTAAGG + Intergenic
1124275188 15:28321275-28321297 GCTTTTTTTTAGGGTATGTAAGG - Intronic
1124307513 15:28590325-28590347 GCTTTTTTTTAGGGTATGTAAGG + Intergenic
1124332664 15:28833443-28833465 GCTTTTTTTTAGGGTATGTAAGG + Intergenic
1124357820 15:29010083-29010105 TTTGATTTTTAGTGGATGCATGG + Intronic
1125823609 15:42656315-42656337 TTTTTTTTTTAGGAGATGGCTGG - Intronic
1126199682 15:45971757-45971779 TCTTACCTTCAGTGGATGGAAGG + Intergenic
1127163456 15:56217192-56217214 TCTTATTCTTAGGAGATGTCAGG - Intronic
1127735647 15:61836225-61836247 TCTTATTTTGTGGGCATGCACGG + Intergenic
1129933168 15:79428923-79428945 TCCTGTCTTTAGGGGAGGGAAGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131021322 15:89101741-89101763 TATGATTTTTAGGGCCTGGAGGG + Intronic
1132372088 15:101306344-101306366 TATTATTTTTGGGGGGTGGCGGG - Intronic
1133572371 16:7054162-7054184 TTTTCTTTTGAGGTGATGGAAGG - Intronic
1133786529 16:8978082-8978104 TCATATTTTTAGGAGAGGGGGGG - Intergenic
1136705717 16:32186917-32186939 TTTTTTTTTTAGGGTATGTAAGG - Intergenic
1136762196 16:32742492-32742514 TTTTTTTTTTAGGGTATGTAAGG + Intergenic
1136805903 16:33127894-33127916 TTTTTTTTTTAGGGTATGTAAGG - Intergenic
1137753352 16:50882714-50882736 TTTTATTTTTTAGAGATGGAAGG + Intergenic
1139866847 16:70068826-70068848 TTTTTTTTTTCGGGGATGGGGGG - Intergenic
1140712937 16:77695117-77695139 TTTTCTTTTTAGGGGGTGGGTGG + Intergenic
1140837967 16:78812723-78812745 TTTTTTTTTTAGGGGGTGGGAGG - Intronic
1203064353 16_KI270728v1_random:1002809-1002831 TTTTTTTTTTAGGGTATGTAAGG + Intergenic
1142552580 17:750184-750206 TTTTTTTTTTCGGAGATGGAGGG - Intronic
1143827927 17:9627899-9627921 TTTTATTTTTTGGGGAGGCAGGG + Intronic
1146566577 17:33918379-33918401 TCTTAGTTGTTGGGGATGCAAGG - Intronic
1147443926 17:40463465-40463487 TCTTATTTTTAGGGTTGGGGCGG + Intergenic
1148531450 17:48397228-48397250 TCTTTCTTTTAGGGGGGGGATGG + Intronic
1148611331 17:48966550-48966572 TCTTTTTTTTTGGGGGGGGATGG - Intronic
1150197308 17:63313717-63313739 TATTATTATTAGGGGAAGCAAGG - Intronic
1151429421 17:74052466-74052488 TTTGGTTTTTAGGAGATGGAAGG + Intergenic
1151992825 17:77588916-77588938 TCTTATTTTTAGTAGAGGCAGGG - Intergenic
1152593240 17:81223682-81223704 TGTGACTTTTAGGGGAAGGATGG - Intergenic
1155569482 18:27176037-27176059 TTGTGTTTTTAGGGGATGGGGGG + Intronic
1156323143 18:36046875-36046897 TTTTTTTTTTAGTGGATGCATGG - Intronic
1156405380 18:36778160-36778182 GCTTATATTTAGGGGATGATGGG + Intronic
1157920860 18:51711387-51711409 TCTGCTTCTTAGGGAATGGAAGG - Intergenic
1158264427 18:55645585-55645607 TTGTATTTTTAGGGGAGGGAGGG - Intronic
1163535991 19:17876854-17876876 TTTTTTTTTTAGGGGGGGGACGG - Intronic
1163605498 19:18273033-18273055 TTTTATTTTTTTGAGATGGACGG + Intronic
1163995060 19:21037288-21037310 TCTTATTTTTAGTAGAGAGAGGG + Intronic
1164284515 19:23801234-23801256 TTTTTTTTTTAGGGGAGGGTTGG + Intronic
1164299035 19:23943012-23943034 TGTTTTTTTTTGGGGAGGGAAGG + Intronic
1165209550 19:34223077-34223099 TCTTTTTTTTGGGGGGTGGAGGG + Intronic
1166347692 19:42176719-42176741 TTTTATTATTTGGGGATGGGGGG - Intronic
926395389 2:12436137-12436159 TCAAATTTGTAGGTGATGGAAGG + Intergenic
926511560 2:13787372-13787394 TCTTTTTTTTGGGGGGGGGAAGG + Intergenic
926544157 2:14218293-14218315 TTTTATTTTTAGGAGATATAGGG - Intergenic
927579164 2:24225824-24225846 TCTTTTTTTGAGAGGAGGGAGGG + Intronic
930664109 2:54084973-54084995 TCTTATTTTTAGGTGAGGCGTGG + Intronic
931238600 2:60432890-60432912 TCTGACTTTGAGAGGATGGAAGG - Intergenic
931651021 2:64468760-64468782 TTTTTTTTGTAGGTGATGGAAGG - Intergenic
931684315 2:64780615-64780637 TTTTATTTTTAGGAGAGGCAGGG + Intergenic
931997453 2:67852766-67852788 TGTTATTCTTAAGAGATGGAAGG + Intergenic
932702664 2:74002248-74002270 TCTTCTTTTTTGAGGATGAAGGG + Intronic
933825379 2:86155269-86155291 TTTTATTTTTATGAGATTGACGG - Intronic
935032942 2:99339546-99339568 TTTTGTTTTTTGGAGATGGAGGG + Intronic
937208822 2:120253891-120253913 TCTGAAGTTTTGGGGATGGATGG + Intronic
938654155 2:133413507-133413529 TGTTATCATTAGGGGAAGGAGGG + Intronic
939208897 2:139145690-139145712 TTTTATTTTTAGGAGATACAGGG - Intergenic
939367517 2:141252195-141252217 TTTTTTTTTTAGGGGGTGGGGGG - Intronic
940051344 2:149468333-149468355 TTTTATTTTTAGGGGATGAGTGG - Intronic
941039691 2:160607133-160607155 TCTTTTTTTTGGGGGGTGGGGGG + Intergenic
941923093 2:170871047-170871069 TCTTCTTTTTTGGGGGTGGAGGG + Intergenic
942234713 2:173892815-173892837 TCTTATTTTTAGTGGAGACAGGG - Intergenic
942930713 2:181489080-181489102 TTTTATTTTTCTGGGGTGGATGG + Intronic
944823870 2:203460308-203460330 TTTTATTTTTAAGGGTGGGATGG - Intronic
945282987 2:208054398-208054420 TCGAATTTATAGGGGAGGGATGG - Intergenic
946057568 2:216915520-216915542 TCTTATTTTTTGAGAAAGGATGG - Intergenic
948622255 2:239243756-239243778 TGTTAGTTGTAGGGCATGGAGGG - Intronic
948622262 2:239243801-239243823 TGTTAGTTGTAGGGCATGGAGGG - Intronic
1169188405 20:3639805-3639827 TGTTCTTTTTAGGGTAGGGAAGG - Intronic
1169660696 20:7975450-7975472 TCTTTTTTTTGAGGGAGGGATGG - Intergenic
1170193709 20:13669281-13669303 TCTTTTTTTTGGGGGGGGGATGG + Intergenic
1170349256 20:15421074-15421096 TGTTTTTTTTAGAGGAAGGACGG - Intronic
1170508427 20:17052888-17052910 TCTTAATTTTGGGGGTGGGAGGG + Intergenic
1170697960 20:18676987-18677009 TTTTCTTTTTAGGGGGTGGGAGG - Intronic
1171486200 20:25488228-25488250 TCTCTTTTTTTGGGGAGGGATGG + Intronic
1171996414 20:31735247-31735269 TCTTTTTTTTAGTGGAGGGTTGG + Intergenic
1172085665 20:32380274-32380296 TCTTTTTTTTATGGGAGGGACGG - Intronic
1172821572 20:37739742-37739764 TGTTCCTTTTAGGAGATGGACGG + Intronic
1172952089 20:38728769-38728791 TCTGATTATTCGGGGATGGGGGG + Exonic
1173359552 20:42329958-42329980 TCATATTTTTAATTGATGGATGG + Intronic
1174162460 20:48561363-48561385 TCTTATTTTTAGTAGAGAGAGGG - Intergenic
1175234423 20:57500095-57500117 TTTTTTTTTTGGTGGATGGAGGG + Intronic
1175501573 20:59454659-59454681 TCCCATTTTTAGGGAAAGGAAGG - Intergenic
1177098251 21:16866537-16866559 TCTTCTTTTTGGGGGGTAGAAGG + Intergenic
1182610742 22:31545519-31545541 TCTTATTTTTTGGGTAGAGATGG + Intronic
1183248407 22:36711275-36711297 TCTTATTTATAGTGCAAGGATGG + Intergenic
1183344019 22:37296916-37296938 TCCTAGTTTTAGGAGTTGGAGGG - Intronic
1185116261 22:48939993-48940015 TCTTATTTACTGGGGAGGGAAGG + Intergenic
1185407657 22:50663859-50663881 TCTTTTTTTTAAGAGATGGGGGG - Intergenic
949271747 3:2225149-2225171 TCTTTTTTTTTGGGGGTGGTGGG - Intronic
951651462 3:24955684-24955706 CCTTTTTTTTAGGGGGTGGAAGG + Intergenic
953021692 3:39118591-39118613 CCTTTTTTTTAGGGGATAGTTGG + Intronic
953168769 3:40488654-40488676 TTTTTTTTTTAGGGGGTGGGGGG + Exonic
956178276 3:66494721-66494743 TCTTTTTTGTAGGGGGTGGTGGG - Intronic
956506084 3:69941720-69941742 TCATATTCTTAGGTGATAGAGGG + Intronic
956755236 3:72379348-72379370 TCTCCTTTTTAGGGGGTGGTGGG + Exonic
957210268 3:77249573-77249595 TCTCATTTTAAAGTGATGGATGG - Intronic
957384482 3:79478389-79478411 TCTTTTTTTTGGGGGGTGGGGGG - Intronic
957400860 3:79711904-79711926 TCTAATTTGTGGGGGATGGGCGG + Intronic
957861291 3:85954765-85954787 TCATATTTTTAGAGAAAGGAAGG - Intronic
957971438 3:87388010-87388032 TCTCATTTTGGGGGGATGGGAGG - Intergenic
958941526 3:100321050-100321072 TCTTTATTTTGGGGAATGGATGG + Intronic
959372328 3:105543115-105543137 GCTTATTTTTAAGAGATGCAAGG + Intronic
959596620 3:108136082-108136104 TATTATTTTTAGTGGATAAATGG + Intergenic
959924335 3:111904661-111904683 GTTTATTTTGAGGGGAGGGAGGG + Intronic
960471734 3:118074893-118074915 TCTTTTGTTTAGGGGAAGTAAGG - Intergenic
962249325 3:133825755-133825777 CCTTCTTTTTTGGGGATGGTGGG - Exonic
962498765 3:135967720-135967742 TTTTCTTTTTGGGGGATGGGGGG - Intronic
962783354 3:138742613-138742635 TCTAAGTTTTCAGGGATGGATGG + Exonic
963829377 3:149990570-149990592 TCTTTCTTTTTGGGGATAGAGGG - Intronic
963926766 3:150959240-150959262 TAATCTTTTTAGGGGAGGGAAGG + Intronic
964801284 3:160561838-160561860 TTTTCTTTTTGGGGGAGGGAAGG - Intronic
964957338 3:162377522-162377544 TGTTATTTTTTGGAGATGGATGG - Intergenic
965055891 3:163715675-163715697 TTTTATTTTTGGGGGGTGGAGGG - Intergenic
965088092 3:164125545-164125567 TTTTTTTTTTAAGGGATGGATGG - Intergenic
965408377 3:168299234-168299256 TCTAATTTTTAGAGGATAGAGGG + Intergenic
965857821 3:173110030-173110052 TCTTATTTTTTGGGGTTAAAAGG + Intronic
966009919 3:175062329-175062351 TCTTATTTTTTGGAGATTGTTGG + Intronic
967656474 3:192056279-192056301 TTTTTTTTTCAGGGGGTGGATGG - Intergenic
967867588 3:194203377-194203399 TTTTATTTGTAGGGGATGTCAGG - Intergenic
970435428 4:16029652-16029674 TCTTTTCTTTAGGGGGTGAAGGG - Intronic
972981689 4:44712092-44712114 TCTTATTTGAAGGAAATGGAAGG + Intronic
974591847 4:63960326-63960348 TTTTATTTTTATGTGATAGAAGG - Intergenic
974863375 4:67550976-67550998 TCTTACTTTTAGGTGAATGATGG - Intergenic
975286447 4:72626927-72626949 TATTATTTTTTGGGGAAGGAAGG + Intergenic
977562299 4:98544892-98544914 TCTTATGTTCAGGGGAGGGATGG + Intronic
978450884 4:108832423-108832445 TCTTTTTTTTAGGGTACAGATGG - Exonic
979111935 4:116769977-116769999 TCTTTTTTTAAAGGAATGGAAGG + Intergenic
979253341 4:118587841-118587863 TCTTATTTCCAGGGGATTCAGGG - Intergenic
981192896 4:141884218-141884240 TCTCATTGTTGTGGGATGGAGGG + Intergenic
981786715 4:148487813-148487835 AATTATTTATAGGGGATGGGAGG - Intergenic
983389439 4:167110369-167110391 ATTTCTTTTTAGGTGATGGAGGG + Intronic
983729067 4:170971233-170971255 TATTTTTTTCAGGGGATGGTTGG + Intergenic
983806157 4:171995325-171995347 TTTAATTTCTAGGAGATGGATGG - Intronic
983995133 4:174173580-174173602 TCTTATGTTGGGGGGAGGGAGGG + Intergenic
984632630 4:182076652-182076674 TCTTAATTTTGGGGGCTGTATGG + Intergenic
986314628 5:6578295-6578317 TGTTCATTTTAGAGGATGGATGG - Intergenic
987885941 5:23812273-23812295 TTTTATTTTTAGGGGGTGAAAGG + Intergenic
988071787 5:26299639-26299661 TTTTATTTTTGGGGTATGTATGG + Intergenic
988294556 5:29338641-29338663 TCATATTTTGAGGGGAAGAAGGG - Intergenic
991271281 5:64784871-64784893 TCTTATTTTTAAGGAATAAATGG - Intronic
992160657 5:73997750-73997772 GCTTATGTTGAGGGGAGGGAGGG - Intergenic
995051019 5:107703629-107703651 TTTTATAATTCGGGGATGGAAGG + Intergenic
995223109 5:109673195-109673217 TCTCAGTTTTAGGCAATGGAGGG + Intergenic
995661757 5:114491846-114491868 TGTTCTTTTTAGGGGGTGTAGGG + Intronic
995841157 5:116444633-116444655 TTATGTTTTTAGGGGATGGGAGG - Exonic
995845754 5:116492008-116492030 ACATATTTTTAGGGGAAAGATGG + Intronic
997083777 5:130772093-130772115 TCTTGTTTTTAGGGGGAGAAGGG + Intergenic
997498380 5:134350600-134350622 TTTTATTTTGAGGTGATGGATGG - Intronic
997934271 5:138097010-138097032 TGTTATTTTGTCGGGATGGAAGG - Intergenic
998665602 5:144293848-144293870 TTTTAATTTAAGGGGATGCATGG - Intronic
1000609983 5:163363550-163363572 TCTAATTTTTATGGGTTAGATGG - Intergenic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1003223583 6:4184576-4184598 TCTTATTGTTGGGGGTTTGAAGG + Intergenic
1004094417 6:12538618-12538640 TCTTCTTTTAAGGGTATGGAGGG + Intergenic
1004446871 6:15708495-15708517 TTTTATTTTGAGGGTCTGGAAGG - Intergenic
1004942899 6:20579892-20579914 TGTTTTTTGTAGGGGAGGGAAGG + Intronic
1007059492 6:38924498-38924520 TCTTTTTTTTGGGGGGGGGATGG - Intronic
1007351878 6:41279437-41279459 TCTTACTTTTACCGGAAGGAGGG - Intronic
1008466043 6:51831995-51832017 TCCTCTTTTGAGGGGAGGGAGGG + Intronic
1008950777 6:57156611-57156633 TGTTTATTTTGGGGGATGGAGGG - Intronic
1009167296 6:60356588-60356610 ACCTTTTTTTAGGAGATGGAGGG + Intergenic
1011758520 6:90531778-90531800 TTTTATTTTTAGTGGAGGCAGGG - Intronic
1012304271 6:97631031-97631053 TATTATTTTTAGGCGATAAAAGG + Intergenic
1013608475 6:111772998-111773020 CCTTATTCTTAGGGGACGGGTGG + Intronic
1013906011 6:115220870-115220892 TCCTTTTTTTAGGGGGTGGGGGG - Intergenic
1013917326 6:115356626-115356648 TTTTATTTCTAGTGGATGGGTGG + Intergenic
1014146531 6:118004495-118004517 TCTGAATTTTAGGTGATGGTAGG - Intronic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1016246347 6:141985954-141985976 TCTTTTTTTTGGGGGGTGGGGGG + Intergenic
1017675442 6:156808786-156808808 TCTTATTTTTACTTGATGAAAGG + Intronic
1019222679 6:170486729-170486751 TTTTATTTTTAATGGATGCATGG - Intergenic
1020360515 7:7322420-7322442 TCTTATCATTAGGGGAGGAATGG + Intergenic
1021235532 7:18138421-18138443 TCCTGGTTTTAGGAGATGGAGGG + Intronic
1021969490 7:25951867-25951889 TCTTTTTATTTGGGGATGGGTGG - Intergenic
1022037403 7:26547626-26547648 GCCTTTTTTCAGGGGATGGAGGG + Intergenic
1025786120 7:64644782-64644804 TGCAATTTTTAGGGGATGGATGG - Intergenic
1026894720 7:74003345-74003367 TCTTATTTCCAGGGAAGGGAGGG + Intergenic
1026988138 7:74567783-74567805 TCTTTTTTTTGGTGGAGGGAGGG + Intronic
1029433568 7:100548296-100548318 TCTTTTTTTTGGGGGTTGGAGGG + Intronic
1029513317 7:101010336-101010358 TCTTATTTTGGGGGGATCGGGGG + Intronic
1030640201 7:111996451-111996473 TCTTATTTTAAGTGGATTTATGG - Intronic
1031259107 7:119493640-119493662 TCTTATTTCTATCTGATGGAGGG - Intergenic
1032123289 7:129172258-129172280 TCTTATTTTTGGGGGTGGGGTGG - Intergenic
1032317035 7:130847771-130847793 TCTTATTTTTCGGGGGTGAGGGG + Intergenic
1032866299 7:135928490-135928512 TCAAATTTTTAGGGGAGGGTGGG - Exonic
1033291635 7:140089630-140089652 ACTTATTTTTATGCCATGGATGG + Exonic
1036195580 8:6710589-6710611 TTTTATTTTTATTGTATGGAGGG + Intronic
1036593811 8:10194255-10194277 TCTTCTTTTTAAGGGGGGGAAGG - Intronic
1036596248 8:10215039-10215061 TCATATGTTTAGAGTATGGAAGG + Intronic
1036960973 8:13244223-13244245 TCTGATTTTTAGGCAATGGAGGG - Intronic
1037505722 8:19527435-19527457 TTCTATTTTTAGGAGTTGGAGGG - Intronic
1037542261 8:19883652-19883674 TGTTATTTTTAGGTGCTGAAAGG - Intergenic
1038889334 8:31701266-31701288 TCTTAGTGATAGGGGAAGGAAGG - Intronic
1040611194 8:48983671-48983693 TCTAATTTTTCTGAGATGGAGGG - Intergenic
1041650706 8:60299403-60299425 TCTCTTTTTTAGGGGAAGAAAGG - Intergenic
1043590065 8:81820976-81820998 TCTTTTTTATAGGTGATGGGTGG - Intronic
1043600103 8:81927304-81927326 TCTTAATTTTAGTGGATTAATGG - Intergenic
1043910393 8:85857400-85857422 TTTTATTTTTAGGGGGTGGAAGG - Intergenic
1044053221 8:87535749-87535771 TCTTATTTAAAGAGGAGGGAAGG - Intronic
1044197498 8:89395359-89395381 ACTTATTTTTAGGTGGTAGAAGG + Intergenic
1044631154 8:94279815-94279837 TTTTATCTTTAGGGAAGGGAGGG - Intergenic
1044704299 8:94993746-94993768 TATTATTTTTGTGGGCTGGATGG - Intronic
1046066073 8:109197898-109197920 AATTATTTTCAGGTGATGGACGG - Intergenic
1046684155 8:117205926-117205948 TATTATTTTTGGGGGTTGGGGGG - Intergenic
1047925200 8:129675967-129675989 TCTTATTTTGATGGAAGGGAGGG + Intergenic
1048235812 8:132689213-132689235 ACTTATTTTTAGGAGCTGGTTGG + Intronic
1048798616 8:138174882-138174904 GCTTATATTTTGGTGATGGAAGG - Intronic
1049736184 8:144207167-144207189 TCTTTTTTTTGGGGGGTGGGGGG + Intronic
1050426667 9:5518452-5518474 TCTTATTTTTAGAGCATGAAAGG - Intronic
1051056327 9:12991534-12991556 TCTTCCTTTTAAAGGATGGAAGG + Intergenic
1052088639 9:24298754-24298776 TTTTATTTTTAAAGTATGGATGG + Intergenic
1052496514 9:29232592-29232614 TCTTATTTTCATAGGATGGATGG + Intergenic
1054705398 9:68456297-68456319 TCTTTTTTTTTGGGGGTGGGGGG + Intronic
1055321073 9:75084040-75084062 TTTTTGGTTTAGGGGATGGAGGG + Intronic
1055359099 9:75469994-75470016 TCTTAATTTAATGTGATGGATGG - Intergenic
1056261870 9:84856743-84856765 TCATTTTTCTTGGGGATGGAGGG + Intronic
1057468739 9:95338936-95338958 TCTTCTTTTTTGGTGAGGGAGGG + Intergenic
1185847606 X:3453554-3453576 ACTTATTTCAAGGGTATGGAAGG + Intergenic
1186367243 X:8908441-8908463 TCTTATTTTTAAAGGTTGGCAGG + Intergenic
1188013840 X:25086069-25086091 ATTTATTTTTAGGGGGTGGAGGG + Intergenic
1188326446 X:28808788-28808810 TATTATTTTTAGGAGAAGGAGGG + Intronic
1188572539 X:31605524-31605546 TTTTATTTTTAGGACATGAATGG + Intronic
1188584223 X:31752689-31752711 TCTTATCTTTTGGGGAGTGAAGG + Intronic
1188592044 X:31849462-31849484 CCTCATTATAAGGGGATGGACGG + Intronic
1188614621 X:32142351-32142373 TCTTTTTCTCAGAGGATGGAAGG - Intronic
1188721665 X:33529607-33529629 TTTTATTTTTAGGGCCTGCATGG + Intergenic
1189115302 X:38336085-38336107 ACTAATTTTGAGGGGTTGGAAGG + Intronic
1191665442 X:63697540-63697562 TCTTCTTCATAGAGGATGGAGGG - Intronic
1192228700 X:69248297-69248319 TCTTTTTTTTGGGGGATGGGGGG - Intergenic
1193639899 X:84000421-84000443 TGTTAATTTTAGGGTATAGAAGG - Intergenic
1193662183 X:84270837-84270859 ATATATTTTTAGGGGATTGATGG + Intergenic
1195095914 X:101501001-101501023 TATAATTTTTAGGGGTTGAATGG + Intronic
1195208716 X:102629664-102629686 TCTGATTTTTAGGAGTAGGAAGG - Intergenic
1196601443 X:117605622-117605644 TCTTGATTTTAGAGGATGTATGG + Intergenic
1197392145 X:125880574-125880596 TCCTATTTTTGGGGCATAGATGG - Intergenic
1197416350 X:126178564-126178586 TCTTATTTTTACTGGGTAGATGG + Intergenic
1197534508 X:127671130-127671152 ACTCACTTTTAGGGGCTGGATGG - Intergenic
1197743521 X:129914581-129914603 TCTTTTTTTTGGGGGAGGGCGGG - Intronic
1198441381 X:136666651-136666673 TCTTGTCTTTTGGGGAGGGAGGG + Exonic
1198541803 X:137648052-137648074 TCCTGTGTTTAGAGGATGGAGGG - Intergenic
1198852774 X:140983228-140983250 TCTTTTTTTTGGGGGGGGGACGG - Intergenic
1199829787 X:151538184-151538206 CCTTCTTTTTTGGGGATGGACGG - Intergenic
1199854398 X:151748449-151748471 TCTTTTTTTTGGGGGGTGGGGGG - Intergenic
1201507890 Y:14724640-14724662 TCTTTTTTTTGGGGGAGGTAGGG + Intronic
1201614003 Y:15875692-15875714 TGCTATTATTAGGGTATGGAAGG + Intergenic
1201616365 Y:15904088-15904110 TGCTATTATTAGGGTATGGAAGG - Intergenic
1202085851 Y:21135913-21135935 TCTTACTTTTTGAGTATGGAAGG + Intergenic