ID: 1118001310

View in Genome Browser
Species Human (GRCh38)
Location 14:61526257-61526279
Sequence GCTGATTTGGAGCCAGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118001298_1118001310 28 Left 1118001298 14:61526206-61526228 CCCACTGAAAACAGTCACTTATA 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1118001310 14:61526257-61526279 GCTGATTTGGAGCCAGGACTGGG 0: 1
1: 0
2: 0
3: 21
4: 219
1118001299_1118001310 27 Left 1118001299 14:61526207-61526229 CCACTGAAAACAGTCACTTATAT 0: 1
1: 0
2: 0
3: 16
4: 240
Right 1118001310 14:61526257-61526279 GCTGATTTGGAGCCAGGACTGGG 0: 1
1: 0
2: 0
3: 21
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118001310 Original CRISPR GCTGATTTGGAGCCAGGACT GGG Intronic
900126019 1:1069246-1069268 GCTGGTTTGGCGGCAGCACTGGG + Intergenic
901379323 1:8862514-8862536 GTGGATGTGGAGCCAGGGCTGGG - Intronic
903190552 1:21653410-21653432 GGTGCTCTGGAGCCTGGACTGGG + Intronic
903683239 1:25111700-25111722 GCTGAACTGCAGCCAGGGCTGGG + Intergenic
904056539 1:27674375-27674397 GATCACTTGGAGCCAGGAGTTGG - Intergenic
904272912 1:29362204-29362226 GCTGGTTTGCACCCAGGGCTGGG + Intergenic
904408171 1:30307378-30307400 GCTGATATGGGGCCCTGACTGGG - Intergenic
904450713 1:30609610-30609632 CCTGATTTGGAGCCAGTCCAGGG + Intergenic
905259863 1:36709614-36709636 TCTGACATGCAGCCAGGACTGGG - Intergenic
905561847 1:38933590-38933612 GCAGAATTGGAGCAAGGACCAGG - Intronic
906298229 1:44662240-44662262 GCTGAGTTGCAGCCAGGCCTGGG - Intronic
907682040 1:56573568-56573590 GCTGGCTTTGAGCCAGGACCTGG - Intronic
910342393 1:86202916-86202938 GCTGATTTGGAGCTTTGATTTGG - Intergenic
911268463 1:95772277-95772299 GCTGCATTGGAGCATGGACTTGG - Intergenic
911282116 1:95942534-95942556 GCTGATATGGAGGCTGAACTGGG + Intergenic
912496135 1:110093153-110093175 CCAGATCTGGAGCCAGAACTTGG + Intergenic
915130351 1:153691476-153691498 GCTGCTTGGGAGCCAGTCCTGGG + Intronic
915166028 1:153948233-153948255 GCTGGATTGGAGCTAGGGCTTGG - Exonic
915623839 1:157102495-157102517 GATGATTTGGTGCCAGGAGTGGG - Intergenic
916397354 1:164405579-164405601 ACTGATTTTGAGTCAGGACTTGG - Intergenic
916716529 1:167451403-167451425 GCTGATTTGAAGCCTGTCCTGGG - Intronic
917627812 1:176863614-176863636 CCTTATTTTAAGCCAGGACTGGG - Exonic
918163037 1:181919145-181919167 GCAGATTTCCAGCCAGGACTGGG - Intergenic
923106194 1:230855820-230855842 GCTTGTTTAGAGCCAGGAGTTGG - Intronic
1063639199 10:7814058-7814080 GCTGGCTTGGATCCAGGAATGGG - Intergenic
1064066671 10:12188050-12188072 GGTCATTTGGACCCAGGAGTTGG + Intronic
1064705568 10:18069517-18069539 GCTGATATGGAGGCAGGATAGGG - Intergenic
1065383666 10:25113881-25113903 GGTGATTTGGGGCTGGGACTAGG - Intergenic
1066049411 10:31620372-31620394 GGTGATTTGGGGCCAGGAGGGGG - Intergenic
1066441709 10:35445605-35445627 GGCTATTTGGAGCCAGGAGTAGG + Intronic
1067440861 10:46308588-46308610 CCTGGTTCTGAGCCAGGACTTGG + Intronic
1067551373 10:47238681-47238703 GTGGAATTGGAGCCAGGACTGGG - Intergenic
1070673891 10:78398719-78398741 GCTCACTTGCAGACAGGACTGGG + Intergenic
1070813805 10:79311314-79311336 CCTGGTCTGGAGCCAGGTCTGGG - Intronic
1070830685 10:79416381-79416403 GCTGAGTTGGAGGCAAGACAAGG - Intronic
1071298334 10:84238506-84238528 GTTGTTTAAGAGCCAGGACTTGG + Intronic
1072964166 10:99956690-99956712 GCTCATTTGGCTCCAGGGCTTGG + Exonic
1073268234 10:102241173-102241195 GCAGACCTGGGGCCAGGACTTGG - Intronic
1074618746 10:115094739-115094761 GCTGATTTGGAATCATAACTCGG - Intronic
1074975355 10:118576686-118576708 TCTGATTTGGAGCAAGGAGCTGG - Intergenic
1075957802 10:126538948-126538970 GCTGAGCTGGAGCCAGGAACTGG + Intronic
1079280235 11:19080676-19080698 GCTGAAGAGGAGGCAGGACTTGG - Intergenic
1083735082 11:64675590-64675612 GCTGCTGCAGAGCCAGGACTGGG + Intronic
1085658592 11:78340863-78340885 GATGATTTTGAGCCAGATCTGGG - Intronic
1087273879 11:96140922-96140944 GCTGCTTTTGACTCAGGACTAGG + Intronic
1088009881 11:104986840-104986862 GCTATTTGGGAGCCAGGAATTGG - Intergenic
1088278759 11:108116339-108116361 GATGACTTGAAGCCAGGAGTTGG - Intergenic
1089503572 11:118947796-118947818 GCAGATTTGAAGGGAGGACTGGG - Intronic
1090111277 11:123911648-123911670 GCTGTCTAGGAGCCAGGAATTGG - Intergenic
1091194572 11:133720099-133720121 GGAGATTTGGAGGAAGGACTGGG + Intergenic
1092869996 12:12797789-12797811 ACTGACTTGGAGAGAGGACTTGG + Intronic
1093581562 12:20790021-20790043 GCTGTTTGGGAGCCAGGAATTGG + Intergenic
1094675074 12:32611992-32612014 GCAAATTTGGAGCCAAGCCTAGG + Intronic
1095789351 12:46147359-46147381 TCTGACTTGGAGTCAGGACTTGG - Intergenic
1095812260 12:46383554-46383576 GCGGACTTGGAGCCAAGAGTGGG + Intergenic
1096807190 12:54148153-54148175 GATGCTTTGGAGTCAGGCCTGGG - Intergenic
1097508695 12:60508102-60508124 GCTGTCTGGGAGCCAGGAATTGG - Intergenic
1097677282 12:62616359-62616381 GCATATTTGGAGCCTGGGCTGGG - Intergenic
1097769754 12:63570048-63570070 GCTGTCTAGGAGCCAGGGCTTGG - Intronic
1099616196 12:84938703-84938725 GCTGGCTGGGAGCCAGGAATTGG - Intergenic
1104236334 12:126941468-126941490 GCTGAGTTGGAGACAGAACATGG + Intergenic
1110463470 13:75773671-75773693 GCTGATTTGGAGGCAAGAGATGG + Intronic
1113640138 13:111951501-111951523 GCTGCTCTGGAGCCAGCACTGGG - Intergenic
1114283416 14:21216484-21216506 GCTCATTTGAGGCCAGGACATGG + Intronic
1114291227 14:21290076-21290098 GATGACTTGAAGCCAGGAGTTGG - Intronic
1115869862 14:37788003-37788025 GCTGACTAGGAAACAGGACTGGG - Intronic
1117244829 14:53874447-53874469 CATGTTTTGGAGCCAGGCCTAGG - Intergenic
1118001310 14:61526257-61526279 GCTGATTTGGAGCCAGGACTGGG + Intronic
1118643534 14:67816315-67816337 GGGGATTTGGAGTCAAGACTGGG - Intronic
1118878826 14:69809070-69809092 GATGATTATGAGCGAGGACTGGG + Intergenic
1119799150 14:77427230-77427252 GCTAATTATGATCCAGGACTTGG - Exonic
1120996781 14:90423549-90423571 GATGATGTGGAGCCAGGGCAGGG - Intergenic
1121413277 14:93762390-93762412 GCTGTGCTGGAGCCAGGACGAGG - Intronic
1121513582 14:94533997-94534019 GCTGATGAGGGGCCAGAACTAGG + Intergenic
1121862858 14:97335993-97336015 GCTGATTCGGACCCAGGACCAGG + Intergenic
1123020033 14:105393393-105393415 GCTGCTTTGGAGCCCAGCCTAGG + Intronic
1125548721 15:40528410-40528432 GCTTGCGTGGAGCCAGGACTGGG + Intergenic
1127449175 15:59100190-59100212 GCTTATTTGGTGCAACGACTTGG + Intergenic
1128672568 15:69585590-69585612 TCTGTCTTGGAGCCTGGACTGGG + Intergenic
1134206440 16:12242056-12242078 GCTGGGTTGGAGTCAGGCCTGGG + Intronic
1134257671 16:12625451-12625473 GCTGAGTTGGAGACCAGACTGGG + Intergenic
1134429806 16:14192932-14192954 GCAGCTTTGGCGGCAGGACTTGG - Intronic
1136461819 16:30416119-30416141 GCTGATTAAGAGCCTGGACTTGG + Intronic
1139458077 16:67098728-67098750 CCTAAATTGGAACCAGGACTAGG - Exonic
1140451528 16:75074844-75074866 GATCACTTGAAGCCAGGACTTGG + Intronic
1141629762 16:85280917-85280939 GCTGAATTGGAACCAGGTCCTGG + Intergenic
1141892615 16:86936686-86936708 TCTGATGTGGAGTCAGCACTCGG + Intergenic
1147367860 17:39971102-39971124 TGGGATTTGGAGCCAGGAGTAGG + Intronic
1147585200 17:41650728-41650750 GCAGAATCGGGGCCAGGACTGGG + Intergenic
1149141489 17:53437496-53437518 GCTGACTTGGACCCTGGCCTTGG + Intergenic
1149727405 17:58910265-58910287 GCTTATTAGTAGCCTGGACTTGG - Intronic
1152132570 17:78485907-78485929 GGTGATTTAGAGGCAGGAATCGG - Intronic
1156890874 18:42187989-42188011 GCTCCTTTGGAGCCAAGATTGGG + Intergenic
1157342575 18:46792308-46792330 ACTGATGTGCAGCCAGGGCTGGG + Intergenic
1157898396 18:51490148-51490170 GCTGCTTTGGAGTCAGGAGGAGG - Intergenic
1158302553 18:56068056-56068078 GCTGCTCTGGAGTCAGCACTAGG + Intergenic
1158415860 18:57249288-57249310 GCTGCTTTGAGGCCAGGACAGGG - Intergenic
1160119419 18:76114736-76114758 CCTGAATTGGATCCTGGACTGGG - Intergenic
1162492434 19:11001355-11001377 GCTGATTGGGAGCCAGAGGTAGG + Intronic
1163506111 19:17707230-17707252 GCTTCTTAGAAGCCAGGACTGGG + Intergenic
1163586623 19:18167927-18167949 ACTGATTTGAACCCAGGACAGGG - Intronic
1163686975 19:18717303-18717325 GCTGTGTGGGAGCCAGGACTGGG + Intronic
1164706785 19:30325746-30325768 GTTGATTTTGTGCCAGGATTTGG - Intronic
1164778432 19:30872803-30872825 GCTGGTTTGGGAGCAGGACTAGG + Intergenic
1165027691 19:32973509-32973531 GCTGATTTGGTGGCAGGAAATGG + Exonic
1165387407 19:35518869-35518891 ACTCATTTGGAGCCAGGAGAGGG + Intergenic
1165661601 19:37585579-37585601 CCTGATATGGAGACAGAACTCGG + Intronic
1167620163 19:50556153-50556175 GCTGATGAGGAAGCAGGACTAGG + Intronic
925417415 2:3680330-3680352 GGTGATGTGGACCCAGGTCTGGG + Intronic
925993187 2:9269917-9269939 GCTGAGCTGGAGCCAGGACAGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930034573 2:47077375-47077397 GCTGCTTTGGCCCCAGGCCTGGG - Intronic
931012101 2:57929180-57929202 GCTGTCCAGGAGCCAGGACTTGG + Intronic
933903314 2:86864708-86864730 GCTGATCTGTAGCCAAGACCAGG - Intergenic
934580058 2:95430645-95430667 GCTATCTTGGAGCCAAGACTTGG + Intergenic
934599389 2:95646080-95646102 GCTATCTTGGAGCCAAGACTTGG - Intergenic
935777201 2:106484239-106484261 GCTGATCTGTAGCCAAGACCAGG + Intergenic
935881743 2:107572438-107572460 GCAGATGTGGAGCCAGGACGAGG + Intergenic
936008445 2:108909847-108909869 GCTCCTTGGGAGCCTGGACTCGG + Intronic
936071102 2:109371893-109371915 GATGACTTGCAGCCAGGCCTGGG - Intronic
938834606 2:135088029-135088051 TCTGTTTTGGAGACAGAACTTGG + Intronic
938953963 2:136281840-136281862 GCTGCCTTGGAGGCAGGTCTGGG - Intergenic
939178582 2:138780100-138780122 GCTGACTTGGAGCCCAGCCTGGG - Intronic
940364026 2:152826097-152826119 TGTGATGTAGAGCCAGGACTCGG + Intergenic
941818348 2:169820949-169820971 GATCATTTGGGGCCAGGAATTGG - Intronic
946166676 2:217868772-217868794 GCTGATTGGGAGCATGGCCTTGG - Intronic
947304541 2:228729168-228729190 GCTGCCTAGGAGCTAGGACTGGG - Intergenic
948554281 2:238796517-238796539 GCTGATGTGGAGCAGGGAGTGGG - Intergenic
948607136 2:239143148-239143170 GCTGTTTTTGAGTCAGCACTGGG - Intronic
1169361169 20:4950608-4950630 CCTGGCTTGGAGTCAGGACTGGG - Intronic
1171164346 20:22957221-22957243 GCTGAGAGGGAGACAGGACTTGG + Intergenic
1171425906 20:25048524-25048546 TCTGATGTGCAGCCAGGGCTGGG + Intronic
1172167124 20:32906320-32906342 GTTGGTTTGGGGCCAGGACTGGG + Intronic
1173020053 20:39259600-39259622 GCTGTTTAGGAGCCAGGGCCTGG - Intergenic
1173609606 20:44356940-44356962 TCTGAAGTGGAGACAGGACTAGG + Intronic
1175217362 20:57398581-57398603 GCTCATCTGGAGCCAGGCGTGGG + Intronic
1176081114 20:63273328-63273350 GCTCCTTCGGACCCAGGACTCGG + Intronic
1176995017 21:15544753-15544775 GCTGTTTGGGAGCCAGGGCCTGG - Intergenic
1178627039 21:34227022-34227044 TCTGATGTGAAGCCAGGGCTGGG + Intergenic
1180984372 22:19895756-19895778 GAGGACTTGGAGCCAGGACAGGG - Intronic
1182417823 22:30232763-30232785 GGTGGTTTGGAGAAAGGACTTGG + Intergenic
949925932 3:9041666-9041688 GCATTTTTGGAGCCATGACTGGG - Intronic
950053536 3:10009123-10009145 GCTGAGTCGGAGCCGGAACTGGG - Intronic
950305180 3:11911400-11911422 GCTGAGTCGGAGCCGGGACTGGG - Intergenic
950396607 3:12738496-12738518 GCTGGTATTGAGCCAGGTCTAGG - Intronic
950583030 3:13875100-13875122 GCTGTCTGGGAGCCAGGCCTGGG + Exonic
953362338 3:42309120-42309142 GCTGTCTGGGAGCCAGGAATTGG + Intergenic
954706309 3:52482453-52482475 GGTGGTTAGGAGCCAGGGCTCGG + Intronic
956717505 3:72091192-72091214 AGAGATTTGGAGCCAGGTCTGGG + Intergenic
959625408 3:108444201-108444223 GTTGATTTGGACCCAGGAAGGGG + Intronic
961106832 3:124249742-124249764 TCTGATTTGGAGCAAAGACCTGG + Intronic
962751472 3:138437214-138437236 GGAGAATTGGAGCCAGGAGTCGG + Intronic
963730901 3:148971002-148971024 GCTGATCTGGAGCCATGATGAGG - Intergenic
964620267 3:158714204-158714226 GCTGATGTGGCCCCAGGACAGGG - Intronic
967667816 3:192195047-192195069 GTTGTCTTGGAGCCAGAACTAGG + Intronic
969367499 4:6706573-6706595 GCTTTTCTGGAGCCAAGACTTGG - Intergenic
970560780 4:17280285-17280307 GATGATTTGAAGCCAGGCTTTGG + Intergenic
975323983 4:73039361-73039383 GCAGATTAGCAGCCAGGATTTGG + Intergenic
976029944 4:80740653-80740675 GCTCGTTAGGAGCCAGGAATTGG + Intronic
976041160 4:80886225-80886247 GCTGTCTGGGAGCCAGGAATTGG - Intronic
976951454 4:90836679-90836701 CCTGATTTGAACCCTGGACTGGG + Intronic
977166860 4:93710705-93710727 GCTGTCTGGGAGCCAGGACCTGG + Intronic
978231116 4:106401146-106401168 GGTAAGTTGGAGCCAGGACATGG + Intergenic
981447908 4:144861738-144861760 ACTTATTTGGTGCCATGACTTGG - Intergenic
989175915 5:38525729-38525751 GTTGATTTAGTGCCAGGACAGGG + Intronic
991364562 5:65854725-65854747 GCTCATTTGAACCCAGGAGTTGG + Intronic
992684043 5:79181903-79181925 GCTAATCTAAAGCCAGGACTTGG - Intronic
994226286 5:97254776-97254798 GTTGTTTGGGAGCCAGGAATTGG - Intergenic
998079994 5:139266893-139266915 GCTGATTTGGAGGCCGGGCGCGG - Intronic
999020365 5:148158875-148158897 GCTTATTTGGGGCCAGGGCTAGG - Intergenic
999459240 5:151743400-151743422 ACTGATTTGAAGCCAGGCTTGGG - Intronic
1000987377 5:167875575-167875597 GCTGCTGTGGAGGTAGGACTGGG + Intronic
1001156088 5:169273479-169273501 TCTAATTTGCAGCCAAGACTGGG - Intronic
1001364146 5:171120341-171120363 GCTGTCTGGGAGCCAGGAATTGG + Intronic
1001748451 5:174109873-174109895 GCTGATTCTCAGCCAGAACTCGG + Intronic
1001995438 5:176153737-176153759 GCTGACTTGCAGCCAGGGGTCGG + Intergenic
1003561363 6:7183541-7183563 TCTGATCTGGAGGCTGGACTTGG - Intronic
1005630220 6:27700288-27700310 GATCATTTGAAGCCAGGAGTTGG + Intergenic
1006076553 6:31536566-31536588 TCTTATTTCGAGCCAGGGCTAGG + Exonic
1007305625 6:40901834-40901856 GCTGATTGGAAGCCAGAACTTGG - Intergenic
1007382427 6:41499462-41499484 CCTGAGATGGAGCCAGGCCTTGG - Intergenic
1007421884 6:41724563-41724585 GATGAGTAGGAGCCAGGCCTGGG + Intronic
1007555924 6:42766299-42766321 GAAGAGTTGGAGCCAGGACAAGG + Intronic
1008641965 6:53473657-53473679 GCTGTTTGGGAGCCAGGAACTGG + Intergenic
1008969921 6:57355601-57355623 GCTGATTTAGGGCAAAGACTAGG + Intronic
1009158888 6:60257411-60257433 GCTGATTTAGGGCAAAGACTAGG + Intergenic
1009803967 6:68578354-68578376 GCTGAATTGTACCCAGGAGTAGG + Intergenic
1009893850 6:69722074-69722096 GCTGTCTGGGAGCCAGGAATTGG - Intronic
1011727966 6:90229980-90230002 GCTAATATGCAGCCAGGGCTGGG - Intronic
1012307432 6:97675586-97675608 GCTGATCTGGAGCCTGGGGTAGG + Intergenic
1018784789 6:167099504-167099526 GCTGAATGGGAGTCTGGACTGGG + Intergenic
1019640432 7:2100700-2100722 GATGATTTGCGGCCAGGACCTGG - Intronic
1021374956 7:19895397-19895419 GCAAAGTTGGAGCCAGGTCTTGG + Intergenic
1027372004 7:77516062-77516084 ACTGATTTGGAGCAGGGCCTGGG + Intergenic
1028354264 7:89887177-89887199 GCTGCTTGGGAGCCAGGGATTGG + Intergenic
1029585610 7:101468882-101468904 GCTTAATGGGAGCCAGGCCTGGG - Intronic
1029825137 7:103184827-103184849 GCTGTCTAGGAGCCAGGGCTTGG - Intergenic
1031999217 7:128253994-128254016 GCTGACTGGGAGGGAGGACTCGG + Intronic
1033226961 7:139570167-139570189 GCTCATTTGCAGCCAAGACTTGG + Exonic
1033229240 7:139583795-139583817 GGTAATTTGGGGCCAGGACAGGG - Exonic
1035393526 7:158521338-158521360 GCTGAGTTAGAGACAGTACTAGG + Intronic
1036649260 8:10631891-10631913 GCGGATTTGGAGTCAGGCCATGG + Intronic
1036807393 8:11844958-11844980 GCTGGGATGTAGCCAGGACTTGG + Exonic
1037636577 8:20705667-20705689 ACTGACTTGAAGCCAGGAGTGGG - Intergenic
1038345383 8:26727403-26727425 GAGGAATTGGAGCCAGGAGTGGG + Intergenic
1038817502 8:30920149-30920171 CCAGAATTGGAGCCAGGATTTGG - Intergenic
1039029662 8:33295623-33295645 GCTGTTTTGGAACCAGGAAATGG - Intergenic
1041735155 8:61103168-61103190 AATGACTTTGAGCCAGGACTGGG + Intronic
1042844404 8:73155931-73155953 GCCGATTAGGAGCCAGAGCTTGG - Intergenic
1043620837 8:82190995-82191017 CCTGAAGTGGAGCCTGGACTGGG - Intergenic
1045745788 8:105419878-105419900 GCTTATTTCCAGCCATGACTTGG + Intronic
1047204353 8:122791388-122791410 GCTGATTGGGAGCCCTGCCTGGG + Intronic
1048935749 8:139355342-139355364 GCTGATTTGCAGCCAGCAACAGG + Intergenic
1049339225 8:142103050-142103072 GATGAGCTGGAGACAGGACTTGG + Intergenic
1049442729 8:142616651-142616673 GCTGACAAGGAGGCAGGACTGGG + Intergenic
1052571169 9:30226226-30226248 GCAGATTTGGAGACTGGATTTGG - Intergenic
1052988617 9:34505621-34505643 GCTGTCTTGGAGCCAGTCCTGGG + Intronic
1053451337 9:38196643-38196665 GTTGGTATGGAGCCATGACTAGG - Intergenic
1061014915 9:127975974-127975996 GTGGATTTGGGGCCAGGCCTGGG - Intronic
1062279187 9:135744442-135744464 GCTGGTGTTGAGCCAGGCCTGGG - Intronic
1062299970 9:135860754-135860776 GCTGATTTGGCACCAAGACATGG - Intronic
1062524826 9:136973940-136973962 GCAGCTTTGGAGCCAGGGCTAGG - Intergenic
1062542523 9:137047956-137047978 TCTGCTCTGGAGCCAGGCCTGGG - Intergenic
1062656779 9:137607691-137607713 ACAGATTTGGAAACAGGACTGGG + Intronic
1186026256 X:5316503-5316525 GATCATTTGAAGCCAGGAGTTGG + Intergenic
1186171202 X:6878936-6878958 GCTGAGATTGAGCCAGGAATCGG - Intergenic
1186670881 X:11765922-11765944 GCTGTGTTGGAGGCAGGACTGGG + Intronic
1187623535 X:21085686-21085708 GTTGTTTTGGAGCTAAGACTTGG - Intergenic
1187625708 X:21111114-21111136 GCTGAGTTTGAGCCAAGATTTGG - Intergenic
1188538007 X:31218867-31218889 GCAGAATTGGAGCGAGAACTGGG - Intronic
1188836485 X:34962729-34962751 GCTTATGTGGAGGCAGGACCAGG + Intergenic
1188950083 X:36360354-36360376 GCAGATCTGGGGCCATGACTGGG + Intronic
1189027192 X:37408101-37408123 GCTGATTTGCGGGCAGGACGTGG - Intronic
1189411814 X:40779427-40779449 GCTGTTTGGGAGCCAGGGCCTGG + Intergenic
1192542505 X:71986762-71986784 ACTGATTTGGTGCCAGAATTTGG - Intergenic
1193660047 X:84246496-84246518 GATCATTTGAAGCCAGGAGTTGG - Intergenic
1194329273 X:92560806-92560828 GATGTCTAGGAGCCAGGACTTGG - Intronic
1194841911 X:98753634-98753656 GCTGTTTAGGAGCCAGGAATTGG + Intergenic
1195615609 X:106909656-106909678 TATGATTTGGAGGCAGGCCTGGG - Intronic
1196510069 X:116499099-116499121 GCTGTCTGGGAGCCAGGAATTGG + Intergenic
1200637972 Y:5679995-5680017 GATGTCTAGGAGCCAGGACTTGG - Intronic