ID: 1118004891

View in Genome Browser
Species Human (GRCh38)
Location 14:61556610-61556632
Sequence TGCGTAACCCCTGCTCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118004891 Original CRISPR TGCGTAACCCCTGCTCCCCT TGG Intronic
900019949 1:181402-181424 TGCGCCACGCCTCCTCCCCTGGG - Intergenic
900514685 1:3075941-3075963 TGCGTGACTCCTCCTCCCCCAGG - Intronic
900569481 1:3351319-3351341 TGAGGAACTCCTGCTCTCCTGGG + Intronic
900928388 1:5720194-5720216 GGCCAAACCCCTGCTCCCCAGGG + Intergenic
901801763 1:11712282-11712304 TGCTTAACCTCTGCTCTGCTGGG + Intronic
905733182 1:40310291-40310313 TGGGTAGCCCCTGATGCCCTGGG + Exonic
907316741 1:53577203-53577225 TGCGCATCCCCTACCCCCCTGGG + Intronic
913278381 1:117161239-117161261 TGTGTAACCCATGCTAGCCTGGG - Intronic
920964270 1:210689320-210689342 TGCCTAACCTGTTCTCCCCTTGG + Intronic
1066541007 10:36446948-36446970 AGCGTCACCTCTGCTCGCCTGGG - Intergenic
1075421076 10:122301134-122301156 TGCGCAACCTTTGCTCCGCTGGG - Intronic
1075722832 10:124597531-124597553 TGCGTGACTCCAGCGCCCCTAGG + Intronic
1076003738 10:126931790-126931812 TGCGTGGCCCCTGCTCTCCCTGG + Intronic
1076203027 10:128573103-128573125 TGCCTGTCCCCTGCTCCCCTGGG - Intergenic
1078324846 11:10371011-10371033 TTCCTACCCCCTACTCCCCTGGG - Intronic
1084213494 11:67634556-67634578 AGGATAACCCCTGCTGCCCTGGG + Intronic
1088957233 11:114623565-114623587 TGGGTAACCACTGTTACCCTTGG + Intergenic
1091373329 12:11018-11040 TGCGCCACGCCTCCTCCCCTGGG - Intergenic
1100089800 12:90955095-90955117 TGCGCAACCCCTGCCTCCCCCGG - Exonic
1102058652 12:109915593-109915615 TGCCCGGCCCCTGCTCCCCTGGG + Intronic
1102279501 12:111607896-111607918 TGTGCAACCCCTGCCTCCCTGGG + Intergenic
1104978857 12:132563986-132564008 TGTGCACCCCCTGCACCCCTCGG + Intronic
1111801151 13:92982604-92982626 GGCTTAACCCCTGCTTACCTAGG + Intergenic
1117370361 14:55072948-55072970 TGTGTACTCCCTGCTCCCCCCGG - Intergenic
1118004891 14:61556610-61556632 TGCGTAACCCCTGCTCCCCTTGG + Intronic
1121989566 14:98542669-98542691 TGCATAATGCCTGCTCCTCTTGG - Intergenic
1126343541 15:47669490-47669512 TCCAAAGCCCCTGCTCCCCTTGG + Intronic
1129183191 15:73889834-73889856 TGCATCACACCTGCTCCCCCAGG + Intergenic
1132644102 16:990889-990911 TGCATAAACCCTGCTCCCCCAGG + Intergenic
1133120297 16:3602392-3602414 TGCGTTCCACCTGCTCCCCATGG - Intronic
1133218310 16:4306889-4306911 TGCGTAACATCTGTTCTCCTGGG - Intergenic
1139102888 16:63789498-63789520 TGAGTTACCCCTGCTCCACATGG - Intergenic
1140282083 16:73564258-73564280 TGCATAACCCCAGGTGCCCTGGG + Intergenic
1140625784 16:76793070-76793092 TGAGGAACACCTGATCCCCTGGG + Intergenic
1142137122 16:88456564-88456586 GACGTGCCCCCTGCTCCCCTTGG - Intronic
1143731597 17:8885475-8885497 TGGGTAACCCCGCCTCCCCAGGG + Intronic
1143731666 17:8885639-8885661 TGGGTAACCCCGCCTCCCCAGGG + Intronic
1143731748 17:8885820-8885842 TGGGTAACCCCGCCTCCCCAGGG + Intronic
1148786853 17:50149801-50149823 TGGGGAACCCCTGCGGCCCTGGG + Exonic
1151635482 17:75344864-75344886 TGAGTAACAGCTGCTCCCCCAGG - Intronic
1152017885 17:77763820-77763842 TGCCTGAGCCCTGCTCACCTGGG - Intergenic
1153608069 18:6854812-6854834 TGGGAAACCCCTCCTCCCATAGG + Intronic
1157431084 18:47627184-47627206 TCAGTATCCCCTGCTACCCTGGG - Intergenic
1166347804 19:42177145-42177167 TGCCTTACCGCTGCTCCCATCGG + Intronic
1166484492 19:43201699-43201721 TCTCTAACCCCTGCTCCACTGGG + Intronic
1167294978 19:48644669-48644691 TCCCTAGCCCCTCCTCCCCTGGG - Intronic
1168281499 19:55308504-55308526 TCCGTCTCCCCTGCTCCGCTGGG - Intronic
928915045 2:36461559-36461581 TGTGTAACTCCTGTTCCCATCGG + Intronic
931221753 2:60295027-60295049 TGGGTGACCCCTGCCCACCTGGG + Intergenic
932193595 2:69763218-69763240 TGGGCAACTCCTCCTCCCCTTGG - Intronic
933835464 2:86241900-86241922 TGCGCAAGCCACGCTCCCCTGGG - Intronic
942748627 2:179264350-179264372 TGCGTAGCCCCTCCGCCCCGCGG + Intronic
946388513 2:219400995-219401017 TTCGAAACCCCTCCTCCCCCAGG - Intergenic
1169291793 20:4359214-4359236 TGCCTGAGCCCTGCTCCCCAGGG + Intergenic
1175508598 20:59505508-59505530 TGCATAACCCCTGCCCCCAGAGG + Intergenic
1175768123 20:61605232-61605254 TTCGTCACCCCTGCACCCCGAGG - Intronic
1176005221 20:62858615-62858637 TGCGTAGCCCCTTCCTCCCTGGG - Intronic
1176005239 20:62858675-62858697 TGCGTAGCCCCTTCCTCCCTGGG - Intronic
1176005248 20:62858705-62858727 TGCGTAGCCCCTTCCTCCCTGGG - Intronic
1176005257 20:62858735-62858757 TGCGTAGCCCCTTCCTCCCTGGG - Intronic
1176005266 20:62858765-62858787 TGCGTAGCCCCTTCCTCCCTGGG - Intronic
1176005275 20:62858795-62858817 TGCGTAGCCCCTTCCTCCCTGGG - Intronic
1176005284 20:62858825-62858847 TGCGTAGCCCCTTCCTCCCTGGG - Intronic
1179798734 21:43800633-43800655 TGCGTCCTCCCTGCTCCCCTTGG + Intronic
1185347769 22:50317859-50317881 TGCTTCTCCCCTGCTCCCCAAGG - Intronic
950493110 3:13318134-13318156 TGCAGAATCGCTGCTCCCCTCGG - Intronic
954036752 3:47854917-47854939 TGCAGAACCCCCGCTCGCCTGGG + Intronic
960167490 3:114420224-114420246 TGCTTACCCCCAGCTCTCCTGGG - Intronic
968132085 3:196197845-196197867 TGGGCAACCCCTGCGCCCCGGGG - Intronic
969161888 4:5267481-5267503 TGAGTAACAACAGCTCCCCTAGG + Intronic
969696854 4:8739923-8739945 TTCTGCACCCCTGCTCCCCTGGG - Intergenic
978016186 4:103749390-103749412 TGGGTAAAACCTGCTCCTCTGGG + Intergenic
982431333 4:155325017-155325039 TGGGTATACACTGCTCCCCTAGG - Intergenic
985136640 4:186792869-186792891 TGAGTTAGCCCTGCTCCACTAGG - Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
1000528043 5:162383301-162383323 TGCTTTAACCCTGCTCCCTTAGG + Intergenic
1012589750 6:100966837-100966859 TGTGTTATCCCTCCTCCCCTTGG - Intergenic
1019282277 7:206464-206486 TGCGTTGGCCCTGGTCCCCTCGG + Intronic
1019785953 7:2977643-2977665 GGCCTAGCCCCTGCTCACCTCGG - Intronic
1024295953 7:47842520-47842542 CGCGGCACCCCTGCTCCACTGGG + Intronic
1027642825 7:80758061-80758083 TCTGTAACACCTACTCCCCTAGG - Intronic
1029968181 7:104762480-104762502 TGCCTTACCCCTCCTGCCCTTGG - Intronic
1031190677 7:118545664-118545686 GACGTATCCCCTGCTACCCTCGG + Intergenic
1034467781 7:151239887-151239909 TGCCCATCCCCTCCTCCCCTGGG - Intronic
1037599100 8:20378761-20378783 AGCGTAACCCCAGCTAACCTTGG - Intergenic
1039228574 8:35418232-35418254 TTGGTAACCCCTGCCTCCCTGGG + Intronic
1039725023 8:40206288-40206310 TGAGTTAGCCCTGCTCCCCAAGG - Intergenic
1042020205 8:64364799-64364821 TCCAAAACCCCTGCTCCCATTGG + Intergenic
1042228783 8:66536526-66536548 TGCCCAAGCCCAGCTCCCCTGGG - Intergenic
1043530815 8:81148032-81148054 GGCGTAACCACTGCTGCTCTTGG - Intergenic
1044564798 8:93651453-93651475 TGAGTAACCCCTGCTCCACAAGG - Intergenic
1047158648 8:122351248-122351270 TGAGTAAACACTGTTCCCCTTGG + Intergenic
1061608258 9:131728109-131728131 TCCTTAACCCCTGCTCCACTGGG - Intronic
1061727510 9:132589706-132589728 TGCGTCTCCCCAGCCCCCCTCGG + Exonic
1061933063 9:133843218-133843240 TGCGTGCTCCCTGCACCCCTCGG - Intronic
1062261041 9:135663556-135663578 GGAGTAACCCCTGCTCTCCCAGG - Intronic
1062294751 9:135818498-135818520 TGCCGAGCCCCTGCTCCTCTAGG + Exonic
1186441637 X:9591863-9591885 TCCTTATCCCCTGCCCCCCTGGG - Intronic
1195138270 X:101932197-101932219 TGCGTCACCCCACCTCCCTTTGG + Intergenic
1198374744 X:136027503-136027525 TGCAGAACCCCTGCTTCCATAGG - Intronic
1200962358 Y:9007235-9007257 TGTGTAGCACCTGCTCACCTAGG - Intergenic
1200963396 Y:9015170-9015192 TGTGAAACACCTGCTCTCCTGGG + Intergenic
1200964981 Y:9027563-9027585 TGTGAAACACCTGCTCACCTGGG + Intergenic
1202149703 Y:21833615-21833637 TGTGAAACACCTGCTCTCCTGGG - Intergenic