ID: 1118008492

View in Genome Browser
Species Human (GRCh38)
Location 14:61586680-61586702
Sequence ATGGCTAAATAAAGGAAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118008492 Original CRISPR ATGGCTAAATAAAGGAAGCC CGG Intronic
900898481 1:5500901-5500923 ATGGGTATATAGAGGAAGGCAGG - Intergenic
902119689 1:14152452-14152474 TATGCTAAATAAAGTAAGCCAGG - Intergenic
904100822 1:28025638-28025660 ATAGCAAAATGAAGGAAACCGGG + Intronic
905935102 1:41817248-41817270 ATGGCTATATAAAAGTAGCTAGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906305710 1:44717527-44717549 ATGGGAACACAAAGGAAGCCAGG - Intronic
907918117 1:58889148-58889170 AAGGCTGAAGAAAGGAAGACCGG - Intergenic
907955190 1:59221557-59221579 ATGGCTGAATAAATGCAGGCAGG - Intergenic
909899050 1:81109800-81109822 ATGGCTGACTAGAGGCAGCCAGG - Intergenic
910418050 1:87022553-87022575 ATGGCTAAATAAAATAAACATGG + Intronic
910667985 1:89744652-89744674 TTGGTTAAATAAATGAAACCAGG - Intronic
914681592 1:149942702-149942724 ATGGCTTAACAAAAGAAGCCGGG + Exonic
916405631 1:164495435-164495457 ATGTCTAAAAAAAAAAAGCCGGG + Intergenic
917728186 1:177847617-177847639 ATGCCTAACTAAAGGGAACCTGG + Intergenic
918017447 1:180649875-180649897 ATGGCTAAATATAGGAGGACTGG - Intronic
921255106 1:213331871-213331893 ATGTCAAAACAAAGGCAGCCTGG - Intergenic
924606095 1:245536876-245536898 GTGTCTCAAGAAAGGAAGCCAGG + Intronic
1064683271 10:17833109-17833131 ATGCCTAAAGAAAGAAAGGCAGG - Intronic
1064896285 10:20241211-20241233 ATGTCTAAATAAAGGTAGCGAGG + Intronic
1065125401 10:22568973-22568995 ATGGCTAACTCAAGTAACCCAGG - Intronic
1065351560 10:24800136-24800158 ATATCTAAATAAGGGAAGGCAGG - Intergenic
1066253020 10:33652482-33652504 TAGGCTAAATAAAATAAGCCAGG - Intergenic
1071536895 10:86440916-86440938 ATGGCTAAAGTAAGGAAACGTGG + Intronic
1071670127 10:87600796-87600818 ATTGTTACATGAAGGAAGCCAGG - Intergenic
1073242859 10:102069457-102069479 ATGGGTAAGAGAAGGAAGCCAGG + Intergenic
1075323695 10:121512768-121512790 ATGAATAAATAAAGGAAGGAGGG + Intronic
1075418733 10:122285289-122285311 ATGGCGAAACCAAGGATGCCAGG - Intronic
1075998376 10:126896001-126896023 ATGTCTAAAGAAAGGAAGGAAGG - Intergenic
1078317267 11:10304270-10304292 ATGGATTAATGAAGGCAGCCAGG + Intergenic
1078694921 11:13621116-13621138 ATGGCTAACTAGATGCAGCCAGG - Intergenic
1086107763 11:83165070-83165092 ATGACAAAATTAAGGAGGCCAGG + Intronic
1086746873 11:90439899-90439921 TTGGCTAAATTAAGGAAACAAGG + Intergenic
1087337606 11:96864018-96864040 ATGGCTAACTATATGCAGCCAGG - Intergenic
1087873507 11:103327257-103327279 ATGGCTAACTAGATGCAGCCAGG - Intronic
1088557720 11:111079736-111079758 ATGGCTAAATAAAAAATTCCTGG - Intergenic
1089981050 11:122772761-122772783 ATGGCTAATTAAAAAAACCCAGG - Intronic
1090310983 11:125739223-125739245 TATGCTAAATGAAGGAAGCCAGG + Intergenic
1093698573 12:22191498-22191520 ATGGCTAAAGAAATGTAGCAAGG - Intronic
1093831470 12:23765489-23765511 ATAAATAATTAAAGGAAGCCTGG + Intronic
1094333265 12:29319682-29319704 ATGGCTAAATTGGTGAAGCCAGG - Intronic
1095183765 12:39177956-39177978 AAAGCTATGTAAAGGAAGCCAGG + Intergenic
1097800264 12:63906155-63906177 CAGGCTAAGTGAAGGAAGCCAGG - Intronic
1098181708 12:67854162-67854184 ATGGAAAAATAAAGGCAGCTTGG - Intergenic
1098258072 12:68637796-68637818 ATTGGTAAATAAAGAAATCCTGG - Intronic
1098347928 12:69525095-69525117 ATGGCTGACTACATGAAGCCAGG - Intronic
1098441365 12:70522800-70522822 ATAGCTAAATAAAGAAAAGCAGG - Intronic
1098807803 12:75042246-75042268 CTGGCTAAACAATGCAAGCCTGG + Exonic
1099424654 12:82507416-82507438 GTGGCTAAGTAAAATAAGCCAGG + Intergenic
1100835095 12:98559207-98559229 ATGACTATAAAAAGAAAGCCTGG + Intergenic
1100941658 12:99729546-99729568 ATGATTAAATAAAGGAAGGTAGG - Intronic
1104177238 12:126344714-126344736 ATGAATAAATAAAGGAAGAAAGG + Intergenic
1107122838 13:36814104-36814126 TATGCTAAATAAAAGAAGCCAGG + Intergenic
1107927279 13:45275149-45275171 ATGTCTAAGTTAAAGAAGCCAGG - Intronic
1109132172 13:58601326-58601348 TTGGCTAGATAAAGGAAGTAAGG + Intergenic
1109326262 13:60870723-60870745 ATGGCCAACTAAATGCAGCCAGG - Intergenic
1110494813 13:76155077-76155099 ATGGCATAAAAAAAGAAGCCAGG - Intergenic
1110513100 13:76376460-76376482 ATTGCTAAGTAAAATAAGCCAGG - Intergenic
1111877555 13:93915959-93915981 ATGGGTGACTACAGGAAGCCAGG + Intronic
1113594726 13:111522929-111522951 ATGGCAAAATAAAGAAAACCAGG + Intergenic
1114054448 14:18954711-18954733 ATTGTTAAATAAAATAAGCCTGG - Intergenic
1114108106 14:19447221-19447243 ATTGTTAAATAAAATAAGCCTGG + Intergenic
1116162516 14:41288200-41288222 ATGGCTGACTAGAGGCAGCCAGG + Intergenic
1117396830 14:55319150-55319172 ATTCCTCAATAAAGGAATCCAGG - Intronic
1118008492 14:61586680-61586702 ATGGCTAAATAAAGGAAGCCCGG + Intronic
1118480647 14:66161841-66161863 ATGGCTACATAAAGGGAGTGAGG + Intergenic
1118834543 14:69467605-69467627 ATGAATAAATAAATAAAGCCAGG + Intergenic
1119433546 14:74583705-74583727 ATGGATAAATAAATGAGGCTAGG - Intronic
1119842328 14:77802574-77802596 TTGATTAAATAAAGGAATCCCGG - Intronic
1120119431 14:80660140-80660162 ATGGGTAAAGAAAGGAAGAGGGG - Intronic
1120200779 14:81535819-81535841 ATGGCTAAGTGAAAGAAGCAAGG - Intergenic
1121263731 14:92584993-92585015 ATAAATAAATAAAGCAAGCCAGG - Intronic
1123202982 14:106684516-106684538 TTTGCATAATAAAGGAAGCCTGG + Intergenic
1202890891 14_KI270722v1_random:156407-156429 ATGGCTAACTAAAAGCTGCCAGG + Intergenic
1123465591 15:20512549-20512571 ATGGGTGAATAGAGGGAGCCAGG + Intergenic
1123652525 15:22488488-22488510 ATGGGTGAATAGAGGGAGCCAGG - Intergenic
1123742947 15:23297347-23297369 ATGGGTGAATAGAGGGAGCCAGG - Intergenic
1124276313 15:28328528-28328550 ATGGGTGAATAGAGGGAGCCAGG + Intergenic
1124306385 15:28583079-28583101 ATGGGTGAATAGAGGGAGCCAGG - Intergenic
1125367454 15:38933016-38933038 ATGGCCAACTAAATGCAGCCAGG - Intergenic
1127358128 15:58221312-58221334 ATTGTTAAATAAAAGAAGCAAGG - Intronic
1128117044 15:65114895-65114917 GTGGCCAGATACAGGAAGCCAGG + Intronic
1129696633 15:77743917-77743939 ATGGATCAATAAATGAAGGCAGG - Intronic
1131640181 15:94283764-94283786 ATGGCCAACTAAATGCAGCCAGG - Intronic
1131747985 15:95470793-95470815 ATAGCTAAATAAAAAATGCCAGG - Intergenic
1133503601 16:6388806-6388828 TCGGCTAAATAAACTAAGCCAGG + Intronic
1133895694 16:9926708-9926730 ATGGATAAATAAACCAACCCAGG + Intronic
1135990923 16:27218297-27218319 ATAAATAAATAAAGGAGGCCAGG + Intronic
1138214961 16:55196192-55196214 TGTGCTAAGTAAAGGAAGCCAGG + Intergenic
1138928646 16:61623956-61623978 ATTGATAAATAAAGCTAGCCTGG - Intergenic
1139049372 16:63104396-63104418 ATGGCATAATGAAGGAAGCATGG - Intergenic
1139308656 16:66009571-66009593 ATGGCTAACTAGATGCAGCCAGG + Intergenic
1140646979 16:77042494-77042516 ATAGTTGAATAAAGGAAGCGAGG + Intergenic
1142051802 16:87963753-87963775 AGTGTTAAATACAGGAAGCCTGG + Intronic
1144888719 17:18481295-18481317 AAGGCTTAACTAAGGAAGCCAGG - Intronic
1145143488 17:20463003-20463025 AAGGCTTAACTAAGGAAGCCAGG + Intronic
1145792361 17:27635624-27635646 AAGGCTTAATTAAGGAAGCCAGG - Intronic
1145807246 17:27743497-27743519 AAGGCTTAATTAAGGAAGCCAGG - Intergenic
1147643747 17:42021131-42021153 ATGGTTAAAGAGAGGAAGCTGGG + Intronic
1148676160 17:49446187-49446209 ATGGCTGACTAAAGGAATTCTGG + Intronic
1149127460 17:53253698-53253720 ATGGCTAAATAAATTAACACAGG - Intergenic
1149279832 17:55091042-55091064 ATGCCTAAGCAAAGGAAGCAAGG + Intronic
1150245099 17:63668802-63668824 TTTGCTGAATGAAGGAAGCCAGG - Intronic
1150335644 17:64328684-64328706 TGGGCAAAACAAAGGAAGCCAGG + Intronic
1150644052 17:66967115-66967137 AGGAATTAATAAAGGAAGCCAGG - Intronic
1150925015 17:69523846-69523868 ATGGCAAAGTAATGTAAGCCAGG + Intronic
1153046397 18:859146-859168 CTGGGTGAATACAGGAAGCCTGG - Intergenic
1153152224 18:2108528-2108550 ATGCCTAAATCAAGAAACCCTGG + Intergenic
1153809019 18:8735475-8735497 ATGGCTTGAAAAAGGCAGCCAGG - Intronic
1153892162 18:9527409-9527431 TTGCCTAAATAAAGGAATCATGG + Intronic
1156995067 18:43455625-43455647 AAGACTAAATAGAGGAAGGCTGG + Intergenic
1158616923 18:58996469-58996491 CTGCATAACTAAAGGAAGCCAGG + Intergenic
1161251549 19:3283137-3283159 ATGGATAAATGAATGAATCCAGG - Intronic
1161567083 19:5009219-5009241 ATGGCTCAATAAAGGAAGCAGGG - Intronic
1163886211 19:19966893-19966915 TTGGCTAAATAGAGAAAGGCGGG - Intergenic
1165654385 19:37520540-37520562 ATGGCTAAATGAAGGGAGGATGG + Intronic
1167779519 19:51590046-51590068 ATGGCTAAATAAATTATGGCAGG - Exonic
1202666311 1_KI270708v1_random:123248-123270 ATGGCTAACTAAAAGCTGCCAGG + Intergenic
926492033 2:13536624-13536646 AGTGCTAAATGAAGGAAGCTAGG + Intergenic
930841492 2:55852119-55852141 ATGGCTAAATAAAAGCAACTAGG - Intergenic
931788898 2:65645980-65646002 ATGAATAATAAAAGGAAGCCAGG - Intergenic
932102812 2:68916214-68916236 AGGGCAAAATGAATGAAGCCTGG + Intergenic
932400141 2:71474816-71474838 ATCGCTCAGTTAAGGAAGCCTGG + Intronic
933563777 2:83923846-83923868 ATGTCTCACTAAAGGAAGCCAGG - Intergenic
938472465 2:131577474-131577496 ATTGTTAAATAAAATAAGCCTGG - Intergenic
939289795 2:140179450-140179472 TTGGATAAATAAATGAAGTCAGG - Intergenic
939514529 2:143150026-143150048 ATGGCGAAATCAAGGATGCTGGG + Intronic
940477120 2:154177276-154177298 ATTGCTAAATTAAAGAAGACAGG + Intronic
940912563 2:159221601-159221623 ATGGCTAAGTGAAATAAGCCAGG - Intronic
942967282 2:181911879-181911901 ATGGGTAAAACAAGGAGGCCTGG - Intronic
944221625 2:197310089-197310111 ACGGATAAATAAAGACAGCCCGG + Intronic
944244772 2:197519889-197519911 ATGTCTAAGAAAAGGAATCCTGG + Intronic
944531462 2:200672020-200672042 TTGTCTAAATGAAAGAAGCCAGG + Intronic
945683330 2:212939107-212939129 ATTGCTAAATAAAGGGAAACTGG - Intergenic
948546864 2:238738878-238738900 AAGGCTAAAGAAAAGAAGTCAGG - Intergenic
1170516345 20:17134242-17134264 ATGCAGAAATAAAGGCAGCCTGG - Intergenic
1170959804 20:21015332-21015354 CTGGGTCACTAAAGGAAGCCAGG - Intergenic
1172738473 20:37147093-37147115 ATGGCTAAGGAAAGGAACCTGGG - Intronic
1173637706 20:44575474-44575496 ATGGCCAAATAAAGCATGACAGG - Intronic
1173990379 20:47297869-47297891 TTGGCTTAATAAAGGGTGCCTGG + Intronic
1174513352 20:51072774-51072796 ATGGATGAGTAGAGGAAGCCGGG + Intergenic
1177026737 21:15930156-15930178 ATATTTAAATAAAGGAAGACAGG - Intergenic
1180472919 22:15677087-15677109 ATTGTTAAATAAAATAAGCCTGG - Intergenic
949746905 3:7305721-7305743 ATGGCTAAATGCAGGAAGATTGG - Intronic
950216667 3:11164727-11164749 AGGACTCAATAAAGGAAGCAGGG - Intronic
950952827 3:17018555-17018577 ATGGCTTAATAATGGAGCCCAGG - Intronic
951309534 3:21106797-21106819 ATGGCTAATTACATGCAGCCAGG - Intergenic
951774946 3:26299693-26299715 ATGACTAAAAAAAGGAGACCTGG - Intergenic
951822302 3:26826799-26826821 ATGGCCAAATAAATGCAGCCAGG + Intergenic
952233920 3:31459418-31459440 ATGGATGAATAAAGAAAGTCTGG + Intergenic
955896717 3:63708126-63708148 CTGCCAAAAGAAAGGAAGCCAGG + Intergenic
957585939 3:82132063-82132085 CTGGCTAAACAAAGGAACTCAGG - Intergenic
957685815 3:83502403-83502425 ATGGCCACAGAAAGGCAGCCTGG - Intergenic
958462525 3:94417957-94417979 ATGGCTGACTAGAGGCAGCCAGG + Intergenic
959655214 3:108796289-108796311 ATTGCTAAATGAAAGAAGCTGGG + Intergenic
959881338 3:111447895-111447917 ATGGCTGAATAGATGCAGCCAGG + Intronic
961205611 3:125079045-125079067 CTGGGTAAGTAAAGGAAGCCAGG - Intergenic
962158429 3:132973857-132973879 ATGGGTAAGTATAAGAAGCCAGG + Intergenic
962608867 3:137055966-137055988 AAGCCTAAAGAAAGGAAGGCTGG - Intergenic
962719463 3:138159219-138159241 ATAAATAAATAAAGCAAGCCGGG + Intergenic
966771271 3:183506093-183506115 ATGGCCTAATGAAGAAAGCCTGG + Intronic
966998376 3:185307898-185307920 ATAGACAAATAAAGGAAGTCAGG - Intronic
969201481 4:5609852-5609874 CTGGCTACATAAAGGAACCTGGG + Intronic
970103440 4:12552960-12552982 CTTGCTGAATAAAGGAGGCCTGG - Intergenic
970319877 4:14864524-14864546 AAGACTAAATAAGGGAACCCTGG + Intergenic
970913244 4:21303956-21303978 ATGGCTTTACAAAGAAAGCCAGG - Intronic
971049116 4:22840680-22840702 ATGGCCAAATAAAGGATTTCAGG - Intergenic
971147296 4:23992598-23992620 ACAGCTAAATGAAGGATGCCTGG + Intergenic
971659035 4:29388414-29388436 ATGGCTTAAAAAAGAAAGCCGGG + Intergenic
971822863 4:31581216-31581238 ATGGTTGTATAAAGGAAGGCTGG + Intergenic
973883227 4:55294777-55294799 AAGGCACAATAAAGGAAGTCAGG + Intergenic
977000329 4:91490357-91490379 ATGGATGAATAAAGGAAACATGG + Intronic
977871690 4:102097956-102097978 ATGGGAAAAGGAAGGAAGCCAGG - Intergenic
978320978 4:107495423-107495445 TATGCTAAATAAAGTAAGCCAGG - Intergenic
979952828 4:126915874-126915896 ATGGAAAAATAATGGAAGCTGGG + Intergenic
980576515 4:134688706-134688728 ATGGCTGACTACAGGCAGCCAGG - Intergenic
980826466 4:138079316-138079338 ATGGCTCAATAAAGCAAAACAGG + Intergenic
981053579 4:140336493-140336515 TATGCTAAATAAAGGAAGCCAGG - Intronic
982166098 4:152614772-152614794 TTGGGTACAAAAAGGAAGCCAGG - Intergenic
982806428 4:159770960-159770982 ATGAATAAATAAAGGAAGTAAGG + Intergenic
983992279 4:174134851-174134873 ATGGCAGAAGACAGGAAGCCTGG + Intergenic
984235954 4:177159395-177159417 ATGGTTGAATAAATGCAGCCAGG + Intergenic
986058363 5:4161920-4161942 ATGGCATAATCCAGGAAGCCTGG + Intergenic
988645801 5:33093643-33093665 ATGGCTGACTAAATGCAGCCAGG - Intergenic
988897280 5:35691399-35691421 ATGGCTGAATAATCGTAGCCTGG - Intronic
996078183 5:119222937-119222959 ATGCCTTAATTAGGGAAGCCAGG - Intronic
998297491 5:140985650-140985672 ATGGCTGAATAAAGGAAGTGGGG + Intronic
1000355299 5:160388761-160388783 ATGGGAAAAAGAAGGAAGCCAGG - Intergenic
1000642356 5:163718105-163718127 ATGGCTAACTAGATGTAGCCAGG + Intergenic
1001213944 5:169837909-169837931 ATGGCTATTTAAAAGAAGCAAGG + Intronic
1001271023 5:170311812-170311834 ATGACTTAATAAAGGAGGGCTGG - Intergenic
1001271763 5:170317902-170317924 ATGGATGAATAAAGAAAGCATGG - Intergenic
1001864069 5:175087787-175087809 ATGTCTAAATAAATGAAGAAAGG - Intergenic
1002511045 5:179718009-179718031 ATGTCTAAAGAAAAGAGGCCAGG - Intronic
1002681425 5:180968311-180968333 TTAGCTAAATGAAGGAAGTCGGG - Intergenic
1004871117 6:19905030-19905052 TTTGCTAAGTAAAAGAAGCCAGG - Intergenic
1005744600 6:28824802-28824824 TTGGCTAAAAACAGAAAGCCTGG - Intergenic
1006819161 6:36877065-36877087 ATTGTTAAGGAAAGGAAGCCAGG - Intronic
1006841475 6:37030707-37030729 AATGCTGAGTAAAGGAAGCCAGG - Intergenic
1007583806 6:42976212-42976234 AAAACTAAATAAAGTAAGCCTGG - Intronic
1008292473 6:49734128-49734150 ATGTGTAAATAAATGAATCCAGG - Intronic
1011584327 6:88908581-88908603 AGGGCTGAGTAAAGGAACCCTGG + Intronic
1012323881 6:97888983-97889005 ATAGCTAAATAGAGGAAGGATGG - Intergenic
1013246988 6:108295756-108295778 ATAACTGAATGAAGGAAGCCAGG - Intronic
1013388679 6:109660442-109660464 ATTGAGAAACAAAGGAAGCCAGG + Intronic
1013393915 6:109714408-109714430 ATGGCTGACTAGAGGCAGCCAGG - Intronic
1013737763 6:113248102-113248124 ATGGCTAACTAGATGCAGCCAGG + Intergenic
1014009452 6:116459618-116459640 TTGACTAAATAACAGAAGCCAGG + Intergenic
1014961424 6:127690831-127690853 GTGGCAAAAGAAAGGTAGCCAGG + Intergenic
1014970455 6:127808434-127808456 GTGACTAAATAAATGAAGCTGGG - Intronic
1015512247 6:134049385-134049407 ATCATGAAATAAAGGAAGCCTGG + Intronic
1016577467 6:145584890-145584912 ATGGCCAATTAAATGCAGCCCGG - Intronic
1017361096 6:153572694-153572716 TTTGCTAAGCAAAGGAAGCCAGG - Intergenic
1023564371 7:41508810-41508832 ATGGCTGCATAAAGGAAGCAGGG + Intergenic
1025195609 7:56930064-56930086 ATGGTTAAGTAAAAGAAGCCAGG - Intergenic
1025676341 7:63646875-63646897 ATGGTTAAGTAAAAGAAGCCAGG + Intergenic
1025734528 7:64135324-64135346 ATGGCAAGATAGGGGAAGCCTGG + Intronic
1027915692 7:84318020-84318042 ATGGATAAAAAATGGAGGCCTGG - Intronic
1028465403 7:91145909-91145931 ATAAATAAATAAAGCAAGCCAGG - Intronic
1028486240 7:91360617-91360639 ATGGGTGAATAAATGAATCCTGG - Intergenic
1029673847 7:102052400-102052422 ATGGTTAAGTAAAAGAAGCCGGG - Intronic
1029716775 7:102332779-102332801 ATGTCTACAAAAAAGAAGCCAGG + Intergenic
1030377667 7:108772188-108772210 ATAGCAAAATAAATGAGGCCTGG + Intergenic
1030807806 7:113937792-113937814 ATGGCCAACTAGAGGCAGCCAGG - Intronic
1033061415 7:138112433-138112455 ATGGCTAAATGAATAAAGTCAGG + Intronic
1033339417 7:140480013-140480035 ATGGCTTAGAAAGGGAAGCCTGG - Intergenic
1033981596 7:147171356-147171378 ATGGCCAACTAGAGGCAGCCAGG - Intronic
1035461853 7:159044620-159044642 ATAGACAAATAAAGGAAACCAGG + Intronic
1037572558 8:20171040-20171062 ATGGCTGAATGCAGGAACCCAGG - Intronic
1038065932 8:23963754-23963776 ATGACTAAACAAAGGCTGCCCGG - Intergenic
1039518148 8:38150084-38150106 ATCTCAAAATAAAGTAAGCCAGG + Intronic
1039939116 8:42074008-42074030 ATGGCTAAAATAAGGAGGACTGG - Intergenic
1040357548 8:46634220-46634242 AAGGATAAAAGAAGGAAGCCTGG + Intergenic
1043139556 8:76571517-76571539 TTGGCTGAAGAAAGGAAGCCAGG + Intergenic
1043917385 8:85938640-85938662 CTGGTTCAATAAGGGAAGCCTGG + Intergenic
1044570060 8:93707394-93707416 TTGGCTAAATCAGGGAAGCATGG - Intronic
1045300474 8:100906414-100906436 ATTGTTAAGTAAAAGAAGCCAGG - Intergenic
1045540450 8:103079359-103079381 ATGGATAAACAATGGCAGCCCGG - Intergenic
1045676746 8:104615444-104615466 ATGGATCCATCAAGGAAGCCGGG - Intronic
1047420271 8:124702321-124702343 ATGGCTAAATAAGGTGAGGCTGG + Intronic
1050070123 9:1801649-1801671 ATTGCTAAGTGAAGGAAGCCAGG + Intergenic
1051310764 9:15768507-15768529 TTTGCTAAATGAAGGAAGGCTGG - Intronic
1052643535 9:31201139-31201161 TAGGCTAAGTAAAGTAAGCCAGG + Intergenic
1053243263 9:36514328-36514350 ATGACAAAAGAGAGGAAGCCAGG + Intergenic
1053503749 9:38622266-38622288 ATGTCGAAATCAAGGACGCCTGG - Intergenic
1055050252 9:71972636-71972658 ATGGTTAAATAATGATAGCCTGG + Intronic
1055328821 9:75160919-75160941 AAGACTAAATAAAGGGAGTCAGG - Intergenic
1057707885 9:97410687-97410709 TTTGCTAAATAAAAGAAGCCAGG + Intergenic
1058601778 9:106678311-106678333 ATGACTAAATAAAGGAAAGAAGG - Intergenic
1061292883 9:129662120-129662142 ATGTATAAATAAAGGACACCTGG - Intergenic
1203487995 Un_GL000224v1:75592-75614 ATGGCTAACTAAAAGCTGCCAGG + Intergenic
1203500616 Un_KI270741v1:17485-17507 ATGGCTAACTAAAAGCTGCCAGG + Intergenic
1185984004 X:4810450-4810472 ATGGCTAAATAAGGCAAACACGG - Intergenic
1186018799 X:5230013-5230035 ATGTCTAAATAAAAGAATCTTGG + Intergenic
1186666086 X:11719146-11719168 ATGGCTAAATTAAACAAGACAGG + Intergenic
1189678185 X:43486190-43486212 ATGGCTGACTAGATGAAGCCAGG + Intergenic
1190006626 X:46745876-46745898 ACAAATAAATAAAGGAAGCCAGG + Intronic
1193883880 X:86960825-86960847 AGGGCTAAATTATGGGAGCCAGG + Intergenic
1194552126 X:95314015-95314037 TTGATTAAATAAAGAAAGCCTGG - Intergenic
1194643574 X:96430961-96430983 ATAGCAAGATAAAGGAAGACTGG + Intergenic
1195393365 X:104386121-104386143 ATGGGTAGACTAAGGAAGCCAGG + Intergenic
1196137446 X:112225461-112225483 ATGGTTAAAAAAAGAAAACCTGG + Intergenic
1196328503 X:114437931-114437953 ATAGGTAAATAAATGAAGACAGG - Intergenic
1198923817 X:141764107-141764129 CTGGCTTCATGAAGGAAGCCTGG + Intergenic
1199196765 X:145041388-145041410 ATGGCCAACTAAATGCAGCCAGG + Intergenic
1200947584 Y:8862113-8862135 CTGGCTTAATGAAGGAAGCCTGG + Intergenic
1201404624 Y:13637056-13637078 AGGGCCAAATAAGGGAAGGCTGG + Intergenic