ID: 1118014139

View in Genome Browser
Species Human (GRCh38)
Location 14:61641058-61641080
Sequence ACTACTTGTGTTTCTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118014139 Original CRISPR ACTACTTGTGTTTCTCCTTG TGG Intronic
901018172 1:6243310-6243332 ACTTCTAGTGCTTCTCCATGGGG + Intergenic
901333636 1:8429872-8429894 ACTGCCTGTGTGTCTCCTCGGGG - Intronic
902141992 1:14364715-14364737 ACAACTTGTCTTTCACCTTCTGG - Intergenic
905049271 1:35035238-35035260 GTTCCTTTTGTTTCTCCTTGTGG + Intergenic
906014017 1:42556985-42557007 ACTACTTTTATTTCTCCTACAGG - Intronic
907358354 1:53894638-53894660 ACTACTTTTGCTGCTCCTTTTGG + Intronic
909481058 1:76129321-76129343 ACTCCTTTAGTTTCTCCTTCTGG - Intronic
910672335 1:89785775-89785797 TCTGCATGTGTTTCTACTTGGGG + Intronic
911662267 1:100515147-100515169 AGTACTTGTGTTTTTCCTTGAGG + Intronic
913502197 1:119481653-119481675 ACTAGTTCTGCTTCTCTTTGAGG - Intergenic
922312317 1:224406620-224406642 ACTACTTCTGATTCTTCTTTGGG + Intronic
1063075828 10:2715454-2715476 ACTATTTGTTTTTCTCCTTTTGG - Intergenic
1064493023 10:15879961-15879983 ACTTCTTGTGATTCTCCTCAGGG + Intergenic
1064650712 10:17506519-17506541 ACTAGTTGGCTTTGTCCTTGGGG - Intergenic
1064737742 10:18400263-18400285 ACTACCTGTGAACCTCCTTGTGG + Intronic
1064775464 10:18772231-18772253 AGCACTTGTGTATCTCCTAGAGG + Intergenic
1066209775 10:33225277-33225299 CGTACTTGATTTTCTCCTTGTGG - Intronic
1070617852 10:77982637-77982659 GCGACTTCTGTTTCACCTTGGGG + Exonic
1071319079 10:84434456-84434478 ACTTCATGTGTTTCTCCCAGTGG + Intronic
1072180093 10:92973740-92973762 TCTACTTCTGTTTCTCCTAAGGG + Intronic
1072293672 10:93989910-93989932 ACTTCTTGTTTTTCTTCTCGAGG - Intergenic
1074747514 10:116549627-116549649 ACTGCTTGTGTTTAAACTTGCGG - Intronic
1075170488 10:120109169-120109191 ACTGCCTGTGTTTCTCCCGGAGG - Intergenic
1075657331 10:124170610-124170632 CCAACTTGTGTTTCTTCTCGTGG + Intergenic
1078125973 11:8563791-8563813 ACTGCTTGTGTTACTCTTTCTGG - Intronic
1078368237 11:10723945-10723967 GCTACTTATGTTTCTCTGTGTGG - Intergenic
1078936062 11:15951221-15951243 ACTGTTTGGGTTCCTCCTTGAGG - Intergenic
1079664710 11:23090016-23090038 TCAATCTGTGTTTCTCCTTGGGG - Intergenic
1079785351 11:24664862-24664884 CCTACTAGAGGTTCTCCTTGAGG - Intronic
1081359064 11:42150325-42150347 ACTTCTAGTGTGTCTCCTTGTGG + Intergenic
1082828112 11:57596064-57596086 AATATTTGTGTGTCTCCTCGGGG - Intergenic
1082884955 11:58071515-58071537 CAGACTTGTGTTTCTCCTAGGGG + Intronic
1084308672 11:68302996-68303018 ACTCCCTCTGTTCCTCCTTGAGG + Intergenic
1087875902 11:103356924-103356946 ACTACTTCTGTTTTTACTTTGGG - Intronic
1088340568 11:108761307-108761329 ATTACTTGTGTTTTTCCTTTTGG + Intronic
1092815470 12:12309154-12309176 ACTACATGTCTTTCTACTTTAGG + Intergenic
1093744308 12:22722262-22722284 ACTCCTTGTGTTTCCTCTTCTGG - Intergenic
1093960540 12:25268438-25268460 ACTACCTGTGCTTCTACTTTAGG - Intergenic
1096248879 12:50013948-50013970 ACTAATTAGGTTTCTCTTTGAGG - Intronic
1097011105 12:55953992-55954014 ATGACTTGTGTTTCCCCTTTGGG + Exonic
1099493463 12:83315239-83315261 CCTACTTGTGTTCCTCACTGAGG - Intergenic
1100061652 12:90585869-90585891 ATTACATGTCTTTCTCCCTGAGG + Intergenic
1100090875 12:90969140-90969162 AATTCCTGTGTTTCCCCTTGTGG - Intronic
1100332421 12:93596899-93596921 ACAAATTGTCTTTCTTCTTGGGG + Intergenic
1100473744 12:94916767-94916789 CCTATTTTAGTTTCTCCTTGAGG + Intronic
1100737466 12:97552777-97552799 GCTACTTGTATTTCTCCTCTTGG + Intergenic
1101748641 12:107564359-107564381 AGTACTACTTTTTCTCCTTGAGG + Intronic
1104220785 12:126783140-126783162 ACTTCATGGGTTTCTCCTTCGGG - Intergenic
1106046034 13:26143114-26143136 ACTAGTTGTGGTTCTCTTTCTGG + Intronic
1106748627 13:32732984-32733006 ACTACTTTTCTTTCTCCTTCAGG - Intronic
1109042146 13:57352707-57352729 AATACATGTGTTTTCCCTTGGGG + Intergenic
1110673123 13:78205971-78205993 ACTACTTGTATTTCTCCACTGGG + Intergenic
1111020168 13:82438514-82438536 CCTAGTTGAGTTTCTCCATGAGG - Intergenic
1111187758 13:84762325-84762347 ACCACTTGTGTATCTTCTTTAGG + Intergenic
1113249213 13:108432274-108432296 ACTACTTGGGTTTCTCTTAAAGG + Intergenic
1114313359 14:21487784-21487806 ATTACTTGTTTCTCTTCTTGTGG + Intronic
1114325262 14:21582439-21582461 AATATTGGTATTTCTCCTTGAGG + Intergenic
1118014139 14:61641058-61641080 ACTACTTGTGTTTCTCCTTGTGG + Intronic
1118433789 14:65750500-65750522 ACTATTTGTGTGACTCCCTGAGG - Intergenic
1119689742 14:76662294-76662316 CCTACTTGTTTTTAGCCTTGGGG - Intergenic
1122885574 14:104708940-104708962 ACTACTTGTCTGTGGCCTTGTGG - Intronic
1125621152 15:41063387-41063409 CCTAATTGTTTTTCTACTTGTGG - Intronic
1127096330 15:55515301-55515323 CCTGCATGTCTTTCTCCTTGTGG + Intergenic
1127813098 15:62581413-62581435 ACTACTTGAGTTTTTCTTTTGGG - Intronic
1131588357 15:93720537-93720559 ACTACATGATTTTGTCCTTGTGG - Intergenic
1131766288 15:95679269-95679291 ACCATTTGTGTTTCTTCTTACGG - Intergenic
1132167239 15:99606062-99606084 ATTTCTTTTGTTTATCCTTGTGG - Intronic
1132341370 15:101080264-101080286 ACTGCTTGTGTTTCCCCTAAGGG - Intergenic
1135485478 16:22861304-22861326 TCTACTTTTGTCTCTGCTTGTGG + Intronic
1139195911 16:64918420-64918442 ACTACCTATGTTTCTCCTCCTGG + Intergenic
1140736753 16:77904960-77904982 ACCAGTTGTTTTTTTCCTTGAGG - Intronic
1141391198 16:83665888-83665910 CCTACTTGTGATTGTCTTTGTGG + Intronic
1142571326 17:876697-876719 ACTCCTTGTGGTTCCCTTTGGGG + Intronic
1149141281 17:53435976-53435998 TCTTCCTGTGCTTCTCCTTGTGG - Intergenic
1149440056 17:56666334-56666356 ACTCCATGTGTTTCTCATTGGGG - Intergenic
1151071330 17:71216259-71216281 ACTCCTTGAGTTTTTCCATGTGG - Intergenic
1152270230 17:79320199-79320221 ACTGCTGGTGTGTCTCCTGGAGG + Intronic
1203168911 17_GL000205v2_random:128608-128630 AGTATTTGTGTTTCTCTATGTGG - Intergenic
1159041643 18:63329075-63329097 ACAACTTGTTTTTCTGCTGGGGG - Exonic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1167388844 19:49181115-49181137 ATTCCTTTTGTTTCTTCTTGGGG + Intronic
925951531 2:8917443-8917465 ACTAATTGTGTATCTTCTTTTGG - Intronic
930162579 2:48173256-48173278 AGTACTTGTTTTTCTTTTTGGGG - Intergenic
930354414 2:50299719-50299741 ACTACTTGTGTTGCTTTATGTGG - Intronic
930696228 2:54414709-54414731 ACTGTTTCTGTTTCTCCTTGGGG - Intergenic
931092510 2:58901197-58901219 AATACTTGGGATTTTCCTTGTGG - Intergenic
931829846 2:66039393-66039415 TATATTTGTGTTTTTCCTTGAGG + Intergenic
931912793 2:66920132-66920154 ACTACTTGTTTTTCCACCTGAGG - Intergenic
933622703 2:84561832-84561854 ACTATTTTTGTATCTCATTGTGG - Intronic
933843731 2:86308558-86308580 ACAACTAGGATTTCTCCTTGTGG + Intronic
937949054 2:127369673-127369695 AATACTTGTTTTTATCCTTCTGG + Intronic
938820542 2:134954120-134954142 GCTCCTTGTGCTTCTCCTTATGG - Exonic
942683341 2:178503558-178503580 AATTCTGATGTTTCTCCTTGTGG + Intronic
943161061 2:184251972-184251994 ACTACTAGTGTGTTTCTTTGAGG - Intergenic
943924869 2:193762035-193762057 ACTGCTTGTCTTAATCCTTGGGG - Intergenic
945087248 2:206144657-206144679 TCTACTTGAATTTCTCCATGTGG + Intronic
1176333015 21:5567129-5567151 AGTATTTGTGTTTCTCTATGTGG + Intergenic
1176394742 21:6253823-6253845 AGTATTTGTGTTTCTCTATGTGG - Intergenic
1176402843 21:6330546-6330568 AGTATTTGTGTTTCTCTATGTGG + Intergenic
1176434314 21:6658558-6658580 AGTATTTGTGTTTCTCTATGTGG - Intergenic
1176442415 21:6735281-6735303 AGTATTTGTGTTTCTCTATGTGG + Intergenic
1176458576 21:6985628-6985650 AGTATTTGTGTTTCTCTATGTGG - Intergenic
1176466677 21:7062351-7062373 AGTATTTGTGTTTCTCTATGTGG + Intronic
1176490238 21:7444129-7444151 AGTATTTGTGTTTCTCTATGTGG + Intergenic
1182642902 22:31782573-31782595 ACCACTTTTGCTTTTCCTTGAGG + Intronic
950663054 3:14478809-14478831 ACTCCTTTTTTATCTCCTTGAGG + Intronic
957174179 3:76784339-76784361 ACTTCTCTTGTTTCTTCTTGGGG + Intronic
958873104 3:99584453-99584475 ACTACTTGTGTTTCTGTCTGAGG - Intergenic
961838693 3:129688024-129688046 ACAAGTTATGTTTCTCCTTCTGG + Intronic
965374303 3:167903308-167903330 ACTACTTGTGTTTTGACCTGAGG - Intergenic
966985945 3:185180542-185180564 AACACTTCTGTATCTCCTTGGGG - Intergenic
968763523 4:2455921-2455943 ATAACTTTTGTTTCTGCTTGAGG + Intronic
970150266 4:13082005-13082027 CCTACTAGAGTTTCTCCATGAGG + Intergenic
971838958 4:31808176-31808198 ACTCTTTGTGCTTCTCCTTGTGG - Intergenic
974083760 4:57238217-57238239 GCTCATAGTGTTTCTCCTTGAGG - Intergenic
975428217 4:74255335-74255357 ACTACATGTTTTTTTCTTTGTGG - Intronic
977050863 4:92127704-92127726 ACCATTTTTGTGTCTCCTTGTGG - Intergenic
977435466 4:96989428-96989450 CCTACTAGAGTTTCTCCATGAGG - Intergenic
977631552 4:99248470-99248492 ACCCCTTGTGCTTCTCCTTGAGG + Intergenic
977646511 4:99418729-99418751 ACTACTGGTGTCTCTCATTCAGG + Intronic
978724533 4:111955046-111955068 ATTACTTGTATTTATCCTTACGG - Intergenic
978771219 4:112457998-112458020 ACCACTGGTATTTCTGCTTGTGG - Intergenic
980952929 4:139399592-139399614 ACTTCTTGTCTGTCTCCTTTAGG - Intronic
982406679 4:155028336-155028358 ATCACTTGTGTTTCTGCTGGTGG - Intergenic
983657488 4:170098114-170098136 CCTACTTGAGGTTCTCCATGAGG + Intergenic
985135365 4:186780549-186780571 ATTGCTTGTGGTTCTCCTTGAGG + Intergenic
985287416 4:188350219-188350241 AAAACTCATGTTTCTCCTTGTGG + Intergenic
986073837 5:4313987-4314009 AGTACTTCCGTTTCTCCCTGTGG + Intergenic
988229910 5:28463028-28463050 TCTACTAGCGTTTCTCCATGTGG + Intergenic
989038222 5:37197845-37197867 ACTACTTTTGTTTTTCTTTTTGG - Intronic
992642847 5:78783527-78783549 ACTTCTTGTTTCTCTGCTTGCGG + Intronic
993083269 5:83329471-83329493 ACTATTTGTGCTTTTCCTTTTGG - Intronic
994423386 5:99551827-99551849 ACAAATTGTGTTTCTCATTATGG - Intergenic
994545329 5:101159599-101159621 ACTAATTTTGTTACTCTTTGAGG + Intergenic
995102424 5:108329177-108329199 TCTACTTGTGTTTCTCCTGTAGG - Intronic
995471888 5:112511061-112511083 ATTATTTGTCTTTCTTCTTGTGG + Intergenic
995510985 5:112908954-112908976 TCTCCTTGTGTGTCTCTTTGTGG - Intronic
999691039 5:154146021-154146043 ACTCTTAGTCTTTCTCCTTGTGG - Intronic
1001072439 5:168598649-168598671 ACTAATTGAGTTTTTCCTTTGGG + Intergenic
1001629601 5:173164915-173164937 TCTCCTTCTGTTCCTCCTTGAGG - Intergenic
1003193852 6:3897745-3897767 AGAACTTGTGTTTCTACCTGGGG - Intergenic
1003440861 6:6140505-6140527 AATATTTCTGTTTCTCCTGGGGG - Intergenic
1004100920 6:12610603-12610625 GCTACTTGTATATCTTCTTGTGG - Intergenic
1005275182 6:24209444-24209466 ACTGCTTCTGTGTCTCATTGGGG - Intronic
1005962531 6:30704251-30704273 CCTATTTGTCTTTCTCCTAGTGG + Exonic
1006298599 6:33181170-33181192 GCTACATGTGTGTCTCCTTCAGG - Exonic
1006380884 6:33696468-33696490 ACCGCTTGTTTTTCTCCTTTTGG + Exonic
1006967318 6:38001323-38001345 ACTACTAGTGTTTGACCTTCTGG + Intronic
1007779392 6:44244084-44244106 ACTCCTTGTGCTTCCCTTTGGGG + Intergenic
1008364752 6:50664771-50664793 ACCAATTGTTTTTCTCCCTGGGG - Intergenic
1008993882 6:57636155-57636177 ACTATTAGTGTTTTTCTTTGTGG - Intronic
1009380302 6:63020031-63020053 ACTACTTTTGTTTCTGCTCCAGG - Intergenic
1009947239 6:70353991-70354013 ATTACTTTTATTTCTCCCTGTGG + Intergenic
1010259451 6:73798535-73798557 AGAACTTGTATGTCTCCTTGTGG - Intronic
1011748973 6:90436319-90436341 ACTATTTGGGGATCTCCTTGAGG - Intergenic
1011780646 6:90785644-90785666 TCTACTTCTGTTTCTCCTCCTGG + Intergenic
1013376168 6:109516929-109516951 ATTTCTTTTTTTTCTCCTTGAGG + Intronic
1014586519 6:123204009-123204031 TCTCCTTGTGTTTATGCTTGTGG - Intergenic
1014859527 6:126447900-126447922 ACTTCTTGTGTTGCTCCTCCGGG + Intergenic
1014955184 6:127606531-127606553 AGTACTTGTGATTCTCCCTGCGG + Intergenic
1015156375 6:130101237-130101259 ACTAGTTGTGTTTATCTTTTGGG + Intronic
1016411509 6:143788084-143788106 ACAACTTCGGTTCCTCCTTGTGG - Intronic
1018275204 6:162122984-162123006 ACTATTTTTGTTTCTCCTGGTGG - Intronic
1020805485 7:12785196-12785218 ACTGGTTTTGTTTCTTCTTGTGG - Intergenic
1022401876 7:30046352-30046374 AGTACTTGCCTTTCTCCTTCTGG - Exonic
1022433288 7:30350026-30350048 ACAACTTGTGTGACTACTTGTGG + Intronic
1022565072 7:31391449-31391471 ACCACTTGCCTTCCTCCTTGAGG - Intergenic
1023462255 7:40411510-40411532 ACTACTTGTCTTTCTCTATTTGG - Intronic
1024439261 7:49396847-49396869 CCTACTTGTGTTTGTCCTCTGGG - Intergenic
1026523238 7:71133597-71133619 GCCGCCTGTGTTTCTCCTTGGGG + Intronic
1026707905 7:72711293-72711315 ACTGCTTCTGTGTCTCTTTGTGG - Intronic
1026811466 7:73470019-73470041 ACTACTAATATTTCTCCTTTAGG + Intronic
1027206830 7:76107076-76107098 GCCACTTCTGTTTCACCTTGAGG - Intergenic
1027634795 7:80657800-80657822 ACTAGTTGTGATTATCCATGAGG - Intronic
1027758892 7:82252512-82252534 ACTATTTTTGTAACTCCTTGAGG - Intronic
1028296126 7:89133848-89133870 TCTCATTGTGTCTCTCCTTGGGG + Intronic
1030021852 7:105283001-105283023 GCTACTTGTTTTTCTTCTTTTGG - Intronic
1030123348 7:106132075-106132097 CCTGCTTGTGGTTCTTCTTGAGG - Intergenic
1030303277 7:107995390-107995412 AATATTTGTGTTTCTACTGGAGG - Intronic
1032651390 7:133882652-133882674 AGTACTTTTGTTTCTCTTTCGGG - Intronic
1035583315 8:753787-753809 AATACTTGTTATTTTCCTTGAGG + Intergenic
1041837223 8:62230150-62230172 AGCACCTGTGTTTCTCCTTTAGG + Intergenic
1042119085 8:65465246-65465268 ACTAGTTGTGGTCCCCCTTGTGG - Intergenic
1046048150 8:108987557-108987579 AGGACTTCTGTGTCTCCTTGTGG - Intergenic
1047196310 8:122725108-122725130 AGCCCTTGTGTTTCTCCTTCTGG + Intergenic
1047390161 8:124443999-124444021 GTTGCTTGTCTTTCTCCTTGGGG - Intergenic
1048486878 8:134856579-134856601 CCTACCTCTGTTCCTCCTTGAGG + Intergenic
1048655629 8:136532714-136532736 ACTACTTGAGATGCCCCTTGTGG + Intergenic
1049128720 8:140816953-140816975 ACTACTGCTTTTTCTCCTTGTGG - Intronic
1050633837 9:7588764-7588786 ACTACATTTTTTTCTCTTTGAGG - Intergenic
1050702295 9:8354271-8354293 ACTTCTTGTGTTTGACTTTGTGG - Intronic
1056493163 9:87128007-87128029 ACCACTTGATTTTCTCCTTTTGG - Intergenic
1057729260 9:97594585-97594607 AGTACTTGGGCTCCTCCTTGGGG + Intronic
1059152945 9:111965763-111965785 ACTACTTCTTTTTCTCCTAGTGG - Intergenic
1059839874 9:118202293-118202315 AGTGTTTGTGATTCTCCTTGTGG + Intergenic
1060292382 9:122315693-122315715 GCTCCTTGTCTTTCTCCTAGGGG + Intronic
1060348637 9:122838328-122838350 ACTACTTGTCTAGCTCCTTTTGG - Intergenic
1060645264 9:125273568-125273590 ACTATTTCTGTGTTTCCTTGTGG - Intronic
1061156184 9:128863193-128863215 CCTCCTTGTGTGTCTACTTGGGG - Intronic
1203429070 Un_GL000195v1:73153-73175 AGTATTTGTGTTTCTCTATGTGG - Intergenic
1203437222 Un_GL000195v1:150084-150106 AGTATTTGTGTTTCTCTGTGTGG + Intergenic
1186393252 X:9182124-9182146 ATTACTTTAGTTTCTCTTTGGGG - Intergenic
1188556840 X:31421679-31421701 ACACCTTGTTTTTCTCTTTGTGG - Intronic
1190416428 X:50184588-50184610 ATTACATATGCTTCTCCTTGGGG + Intergenic
1192315133 X:70045261-70045283 ATTAATTCTCTTTCTCCTTGTGG - Intronic
1194071180 X:89328232-89328254 ATGATTTGTTTTTCTCCTTGAGG + Intergenic
1194829440 X:98603081-98603103 ACTTGTTGTGTTTTTCCTTTGGG + Intergenic
1198201766 X:134427695-134427717 ACTACCTGTTTTTCTCACTGTGG + Exonic
1199747617 X:150783818-150783840 ACTACCTGAGCTTCTCCTTCCGG - Intronic
1202180352 Y:22134480-22134502 ACTGCTAGTGTCTCTCCCTGAGG + Intergenic
1202211008 Y:22451919-22451941 ACTGCTAGTGTCTCTCCCTGAGG - Intergenic