ID: 1118024067

View in Genome Browser
Species Human (GRCh38)
Location 14:61751160-61751182
Sequence CCCGAGCACGTACTGAGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024067_1118024079 21 Left 1118024067 14:61751160-61751182 CCACGCCTCAGTACGTGCTCGGG No data
Right 1118024079 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data
1118024067_1118024073 9 Left 1118024067 14:61751160-61751182 CCACGCCTCAGTACGTGCTCGGG No data
Right 1118024073 14:61751192-61751214 GCAGTCCCGGGCCCCGCCCGCGG No data
1118024067_1118024081 22 Left 1118024067 14:61751160-61751182 CCACGCCTCAGTACGTGCTCGGG No data
Right 1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG No data
1118024067_1118024076 15 Left 1118024067 14:61751160-61751182 CCACGCCTCAGTACGTGCTCGGG No data
Right 1118024076 14:61751198-61751220 CCGGGCCCCGCCCGCGGCCCCGG No data
1118024067_1118024071 -3 Left 1118024067 14:61751160-61751182 CCACGCCTCAGTACGTGCTCGGG No data
Right 1118024071 14:61751180-61751202 GGGCGCAGCACCGCAGTCCCGGG No data
1118024067_1118024085 30 Left 1118024067 14:61751160-61751182 CCACGCCTCAGTACGTGCTCGGG No data
Right 1118024085 14:61751213-61751235 GGCCCCGGCCGTGGGCTCCAGGG No data
1118024067_1118024084 29 Left 1118024067 14:61751160-61751182 CCACGCCTCAGTACGTGCTCGGG No data
Right 1118024084 14:61751212-61751234 CGGCCCCGGCCGTGGGCTCCAGG No data
1118024067_1118024070 -4 Left 1118024067 14:61751160-61751182 CCACGCCTCAGTACGTGCTCGGG No data
Right 1118024070 14:61751179-61751201 CGGGCGCAGCACCGCAGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024067 Original CRISPR CCCGAGCACGTACTGAGGCG TGG (reversed) Intergenic